ID: 1137828736

View in Genome Browser
Species Human (GRCh38)
Location 16:51523870-51523892
Sequence CTGGATCAGGAGCAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137828726_1137828736 30 Left 1137828726 16:51523817-51523839 CCATTACCCAACAGACATGGGTA No data
Right 1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG No data
1137828727_1137828736 24 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG No data
1137828728_1137828736 23 Left 1137828728 16:51523824-51523846 CCAACAGACATGGGTAGCAATGC No data
Right 1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137828736 Original CRISPR CTGGATCAGGAGCAGGAAGA TGG Intergenic
No off target data available for this crispr