ID: 1137831423

View in Genome Browser
Species Human (GRCh38)
Location 16:51546853-51546875
Sequence GTTTTGTCTTTGGTGACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137831423_1137831425 -10 Left 1137831423 16:51546853-51546875 CCTACTGTCACCAAAGACAAAAC No data
Right 1137831425 16:51546866-51546888 AAGACAAAACAGATATTCAGAGG No data
1137831423_1137831427 15 Left 1137831423 16:51546853-51546875 CCTACTGTCACCAAAGACAAAAC No data
Right 1137831427 16:51546891-51546913 ATGTAGCCCCCAGTACATCAGGG No data
1137831423_1137831426 14 Left 1137831423 16:51546853-51546875 CCTACTGTCACCAAAGACAAAAC No data
Right 1137831426 16:51546890-51546912 GATGTAGCCCCCAGTACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137831423 Original CRISPR GTTTTGTCTTTGGTGACAGT AGG (reversed) Intergenic