ID: 1137831424 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:51546863-51546885 |
| Sequence | CTGAATATCTGTTTTGTCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137831424_1137831432 | 22 | Left | 1137831424 | 16:51546863-51546885 | CCAAAGACAAAACAGATATTCAG | No data | ||
| Right | 1137831432 | 16:51546908-51546930 | TCAGGGTTAAATAGCAAAATTGG | No data | ||||
| 1137831424_1137831426 | 4 | Left | 1137831424 | 16:51546863-51546885 | CCAAAGACAAAACAGATATTCAG | No data | ||
| Right | 1137831426 | 16:51546890-51546912 | GATGTAGCCCCCAGTACATCAGG | No data | ||||
| 1137831424_1137831427 | 5 | Left | 1137831424 | 16:51546863-51546885 | CCAAAGACAAAACAGATATTCAG | No data | ||
| Right | 1137831427 | 16:51546891-51546913 | ATGTAGCCCCCAGTACATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137831424 | Original CRISPR | CTGAATATCTGTTTTGTCTT TGG (reversed) | Intergenic | ||