ID: 1137831424

View in Genome Browser
Species Human (GRCh38)
Location 16:51546863-51546885
Sequence CTGAATATCTGTTTTGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137831424_1137831432 22 Left 1137831424 16:51546863-51546885 CCAAAGACAAAACAGATATTCAG No data
Right 1137831432 16:51546908-51546930 TCAGGGTTAAATAGCAAAATTGG No data
1137831424_1137831426 4 Left 1137831424 16:51546863-51546885 CCAAAGACAAAACAGATATTCAG No data
Right 1137831426 16:51546890-51546912 GATGTAGCCCCCAGTACATCAGG No data
1137831424_1137831427 5 Left 1137831424 16:51546863-51546885 CCAAAGACAAAACAGATATTCAG No data
Right 1137831427 16:51546891-51546913 ATGTAGCCCCCAGTACATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137831424 Original CRISPR CTGAATATCTGTTTTGTCTT TGG (reversed) Intergenic