ID: 1137831427

View in Genome Browser
Species Human (GRCh38)
Location 16:51546891-51546913
Sequence ATGTAGCCCCCAGTACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137831423_1137831427 15 Left 1137831423 16:51546853-51546875 CCTACTGTCACCAAAGACAAAAC No data
Right 1137831427 16:51546891-51546913 ATGTAGCCCCCAGTACATCAGGG No data
1137831424_1137831427 5 Left 1137831424 16:51546863-51546885 CCAAAGACAAAACAGATATTCAG No data
Right 1137831427 16:51546891-51546913 ATGTAGCCCCCAGTACATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137831427 Original CRISPR ATGTAGCCCCCAGTACATCA GGG Intergenic