ID: 1137835267

View in Genome Browser
Species Human (GRCh38)
Location 16:51586128-51586150
Sequence CTATAACGTCCTACGTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137835263_1137835267 13 Left 1137835263 16:51586092-51586114 CCAACGTCTTTTCATCTAATGCA No data
Right 1137835267 16:51586128-51586150 CTATAACGTCCTACGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137835267 Original CRISPR CTATAACGTCCTACGTAACC TGG Intergenic
No off target data available for this crispr