ID: 1137836969

View in Genome Browser
Species Human (GRCh38)
Location 16:51601535-51601557
Sequence GTGTTGTAACAGGAACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137836962_1137836969 18 Left 1137836962 16:51601494-51601516 CCCATACATTCCCTGTGCATCTC No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836958_1137836969 28 Left 1137836958 16:51601484-51601506 CCCTTTCCCACCCATACATTCCC No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836963_1137836969 17 Left 1137836963 16:51601495-51601517 CCATACATTCCCTGTGCATCTCT No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836964_1137836969 8 Left 1137836964 16:51601504-51601526 CCCTGTGCATCTCTGTCATTTGG No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836959_1137836969 27 Left 1137836959 16:51601485-51601507 CCTTTCCCACCCATACATTCCCT No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836960_1137836969 22 Left 1137836960 16:51601490-51601512 CCCACCCATACATTCCCTGTGCA No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836966_1137836969 7 Left 1137836966 16:51601505-51601527 CCTGTGCATCTCTGTCATTTGGC No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data
1137836961_1137836969 21 Left 1137836961 16:51601491-51601513 CCACCCATACATTCCCTGTGCAT No data
Right 1137836969 16:51601535-51601557 GTGTTGTAACAGGAACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137836969 Original CRISPR GTGTTGTAACAGGAACACAC TGG Intergenic
No off target data available for this crispr