ID: 1137839863

View in Genome Browser
Species Human (GRCh38)
Location 16:51630375-51630397
Sequence GTTTAAGGGCTCTGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137839856_1137839863 30 Left 1137839856 16:51630322-51630344 CCAGGGGCTCTACTTTCAAACAG No data
Right 1137839863 16:51630375-51630397 GTTTAAGGGCTCTGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137839863 Original CRISPR GTTTAAGGGCTCTGGGAGGC AGG Intergenic