ID: 1137842615

View in Genome Browser
Species Human (GRCh38)
Location 16:51653960-51653982
Sequence TGCCCAGCTGAGGCAGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137842615_1137842625 26 Left 1137842615 16:51653960-51653982 CCCATGCCTGCCTCAGCTGGGCA No data
Right 1137842625 16:51654009-51654031 TGCAGAGAGGGTCCCCTGAAGGG No data
1137842615_1137842626 27 Left 1137842615 16:51653960-51653982 CCCATGCCTGCCTCAGCTGGGCA No data
Right 1137842626 16:51654010-51654032 GCAGAGAGGGTCCCCTGAAGGGG No data
1137842615_1137842620 14 Left 1137842615 16:51653960-51653982 CCCATGCCTGCCTCAGCTGGGCA No data
Right 1137842620 16:51653997-51654019 CTCCCCTCATACTGCAGAGAGGG No data
1137842615_1137842619 13 Left 1137842615 16:51653960-51653982 CCCATGCCTGCCTCAGCTGGGCA No data
Right 1137842619 16:51653996-51654018 ACTCCCCTCATACTGCAGAGAGG No data
1137842615_1137842624 25 Left 1137842615 16:51653960-51653982 CCCATGCCTGCCTCAGCTGGGCA No data
Right 1137842624 16:51654008-51654030 CTGCAGAGAGGGTCCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137842615 Original CRISPR TGCCCAGCTGAGGCAGGCAT GGG (reversed) Intergenic
No off target data available for this crispr