ID: 1137843151

View in Genome Browser
Species Human (GRCh38)
Location 16:51659655-51659677
Sequence GGTATGTTGGCTTTGTCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137843144_1137843151 13 Left 1137843144 16:51659619-51659641 CCTGAATTCTCTTTGTTTTTCAG No data
Right 1137843151 16:51659655-51659677 GGTATGTTGGCTTTGTCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137843151 Original CRISPR GGTATGTTGGCTTTGTCTTC GGG Intergenic
No off target data available for this crispr