ID: 1137846649

View in Genome Browser
Species Human (GRCh38)
Location 16:51696322-51696344
Sequence TGTTAACCATTCGGAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137846649_1137846659 4 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846659 16:51696349-51696371 TCATATGCAGGAGGGGGAAGGGG No data
1137846649_1137846651 -8 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846651 16:51696337-51696359 GGTTAACACCGCTCATATGCAGG No data
1137846649_1137846655 -2 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846655 16:51696343-51696365 CACCGCTCATATGCAGGAGGGGG No data
1137846649_1137846657 2 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG No data
1137846649_1137846652 -5 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846652 16:51696340-51696362 TAACACCGCTCATATGCAGGAGG No data
1137846649_1137846660 8 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846660 16:51696353-51696375 ATGCAGGAGGGGGAAGGGGCAGG No data
1137846649_1137846654 -3 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846654 16:51696342-51696364 ACACCGCTCATATGCAGGAGGGG No data
1137846649_1137846658 3 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846658 16:51696348-51696370 CTCATATGCAGGAGGGGGAAGGG No data
1137846649_1137846653 -4 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846653 16:51696341-51696363 AACACCGCTCATATGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137846649 Original CRISPR TGTTAACCATTCGGAGACAC AGG (reversed) Intergenic
No off target data available for this crispr