ID: 1137846650

View in Genome Browser
Species Human (GRCh38)
Location 16:51696331-51696353
Sequence TATGAGCGGTGTTAACCATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137846650_1137846658 -6 Left 1137846650 16:51696331-51696353 CCGAATGGTTAACACCGCTCATA No data
Right 1137846658 16:51696348-51696370 CTCATATGCAGGAGGGGGAAGGG No data
1137846650_1137846661 22 Left 1137846650 16:51696331-51696353 CCGAATGGTTAACACCGCTCATA No data
Right 1137846661 16:51696376-51696398 TTTACCTCCTACAGAGTTTATGG No data
1137846650_1137846657 -7 Left 1137846650 16:51696331-51696353 CCGAATGGTTAACACCGCTCATA No data
Right 1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG No data
1137846650_1137846660 -1 Left 1137846650 16:51696331-51696353 CCGAATGGTTAACACCGCTCATA No data
Right 1137846660 16:51696353-51696375 ATGCAGGAGGGGGAAGGGGCAGG No data
1137846650_1137846659 -5 Left 1137846650 16:51696331-51696353 CCGAATGGTTAACACCGCTCATA No data
Right 1137846659 16:51696349-51696371 TCATATGCAGGAGGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137846650 Original CRISPR TATGAGCGGTGTTAACCATT CGG (reversed) Intergenic
No off target data available for this crispr