ID: 1137846657

View in Genome Browser
Species Human (GRCh38)
Location 16:51696347-51696369
Sequence GCTCATATGCAGGAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137846650_1137846657 -7 Left 1137846650 16:51696331-51696353 CCGAATGGTTAACACCGCTCATA No data
Right 1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG No data
1137846646_1137846657 20 Left 1137846646 16:51696304-51696326 CCAGTTCTGTGTGTCCTGCCTGT No data
Right 1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG No data
1137846648_1137846657 6 Left 1137846648 16:51696318-51696340 CCTGCCTGTGTCTCCGAATGGTT No data
Right 1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG No data
1137846649_1137846657 2 Left 1137846649 16:51696322-51696344 CCTGTGTCTCCGAATGGTTAACA No data
Right 1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137846657 Original CRISPR GCTCATATGCAGGAGGGGGA AGG Intergenic
No off target data available for this crispr