ID: 1137848083

View in Genome Browser
Species Human (GRCh38)
Location 16:51711590-51711612
Sequence GGAAAATGGCCTTCATGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137848077_1137848083 -2 Left 1137848077 16:51711569-51711591 CCTGGCAGGTAAGTGCCAGGTGG No data
Right 1137848083 16:51711590-51711612 GGAAAATGGCCTTCATGGGAAGG No data
1137848075_1137848083 11 Left 1137848075 16:51711556-51711578 CCATTTTCAGCTTCCTGGCAGGT No data
Right 1137848083 16:51711590-51711612 GGAAAATGGCCTTCATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137848083 Original CRISPR GGAAAATGGCCTTCATGGGA AGG Intergenic
No off target data available for this crispr