ID: 1137852044

View in Genome Browser
Species Human (GRCh38)
Location 16:51755435-51755457
Sequence CGTCAGCCCGAGGAATGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137852044_1137852049 7 Left 1137852044 16:51755435-51755457 CCTGCGCATTCCTCGGGCTGACG No data
Right 1137852049 16:51755465-51755487 AAATACCAATGCGTCCAGCAGGG No data
1137852044_1137852053 30 Left 1137852044 16:51755435-51755457 CCTGCGCATTCCTCGGGCTGACG No data
Right 1137852053 16:51755488-51755510 AGGAAGTATGTATCTCCCACTGG No data
1137852044_1137852048 6 Left 1137852044 16:51755435-51755457 CCTGCGCATTCCTCGGGCTGACG No data
Right 1137852048 16:51755464-51755486 AAAATACCAATGCGTCCAGCAGG No data
1137852044_1137852050 10 Left 1137852044 16:51755435-51755457 CCTGCGCATTCCTCGGGCTGACG No data
Right 1137852050 16:51755468-51755490 TACCAATGCGTCCAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137852044 Original CRISPR CGTCAGCCCGAGGAATGCGC AGG (reversed) Intergenic
No off target data available for this crispr