ID: 1137853277

View in Genome Browser
Species Human (GRCh38)
Location 16:51767734-51767756
Sequence GTGTGAGCTCTTAGGCAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853277_1137853285 19 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853285 16:51767776-51767798 CCGTGGACGCGCGCGCGTGTGGG No data
1137853277_1137853288 26 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853277_1137853286 22 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853286 16:51767779-51767801 TGGACGCGCGCGCGTGTGGGAGG No data
1137853277_1137853281 2 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853281 16:51767759-51767781 TGGTGCCAAACTAAGCTCCGTGG No data
1137853277_1137853283 18 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853283 16:51767775-51767797 TCCGTGGACGCGCGCGCGTGTGG No data
1137853277_1137853287 23 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853287 16:51767780-51767802 GGACGCGCGCGCGTGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853277 Original CRISPR GTGTGAGCTCTTAGGCAACG TGG (reversed) Intergenic