ID: 1137853279

View in Genome Browser
Species Human (GRCh38)
Location 16:51767742-51767764
Sequence GCACCAAGGTGTGAGCTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853279_1137853287 15 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853287 16:51767780-51767802 GGACGCGCGCGCGTGTGGGAGGG No data
1137853279_1137853283 10 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853283 16:51767775-51767797 TCCGTGGACGCGCGCGCGTGTGG No data
1137853279_1137853285 11 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853285 16:51767776-51767798 CCGTGGACGCGCGCGCGTGTGGG No data
1137853279_1137853281 -6 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853281 16:51767759-51767781 TGGTGCCAAACTAAGCTCCGTGG No data
1137853279_1137853288 18 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853279_1137853286 14 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853286 16:51767779-51767801 TGGACGCGCGCGCGTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853279 Original CRISPR GCACCAAGGTGTGAGCTCTT AGG (reversed) Intergenic