ID: 1137853280

View in Genome Browser
Species Human (GRCh38)
Location 16:51767756-51767778
Sequence CGGAGCTTAGTTTGGCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853280_1137853287 1 Left 1137853280 16:51767756-51767778 CCTTGGTGCCAAACTAAGCTCCG No data
Right 1137853287 16:51767780-51767802 GGACGCGCGCGCGTGTGGGAGGG No data
1137853280_1137853285 -3 Left 1137853280 16:51767756-51767778 CCTTGGTGCCAAACTAAGCTCCG No data
Right 1137853285 16:51767776-51767798 CCGTGGACGCGCGCGCGTGTGGG No data
1137853280_1137853288 4 Left 1137853280 16:51767756-51767778 CCTTGGTGCCAAACTAAGCTCCG No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853280_1137853286 0 Left 1137853280 16:51767756-51767778 CCTTGGTGCCAAACTAAGCTCCG No data
Right 1137853286 16:51767779-51767801 TGGACGCGCGCGCGTGTGGGAGG No data
1137853280_1137853283 -4 Left 1137853280 16:51767756-51767778 CCTTGGTGCCAAACTAAGCTCCG No data
Right 1137853283 16:51767775-51767797 TCCGTGGACGCGCGCGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853280 Original CRISPR CGGAGCTTAGTTTGGCACCA AGG (reversed) Intergenic