ID: 1137853282

View in Genome Browser
Species Human (GRCh38)
Location 16:51767764-51767786
Sequence CGCGTCCACGGAGCTTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853282_1137853286 -8 Left 1137853282 16:51767764-51767786 CCAAACTAAGCTCCGTGGACGCG No data
Right 1137853286 16:51767779-51767801 TGGACGCGCGCGCGTGTGGGAGG No data
1137853282_1137853287 -7 Left 1137853282 16:51767764-51767786 CCAAACTAAGCTCCGTGGACGCG No data
Right 1137853287 16:51767780-51767802 GGACGCGCGCGCGTGTGGGAGGG No data
1137853282_1137853288 -4 Left 1137853282 16:51767764-51767786 CCAAACTAAGCTCCGTGGACGCG No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853282 Original CRISPR CGCGTCCACGGAGCTTAGTT TGG (reversed) Intergenic