ID: 1137853288

View in Genome Browser
Species Human (GRCh38)
Location 16:51767783-51767805
Sequence CGCGCGCGCGTGTGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853279_1137853288 18 Left 1137853279 16:51767742-51767764 CCTAAGAGCTCACACCTTGGTGC No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853277_1137853288 26 Left 1137853277 16:51767734-51767756 CCACGTTGCCTAAGAGCTCACAC No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853276_1137853288 27 Left 1137853276 16:51767733-51767755 CCCACGTTGCCTAAGAGCTCACA No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853280_1137853288 4 Left 1137853280 16:51767756-51767778 CCTTGGTGCCAAACTAAGCTCCG No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data
1137853282_1137853288 -4 Left 1137853282 16:51767764-51767786 CCAAACTAAGCTCCGTGGACGCG No data
Right 1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853288 Original CRISPR CGCGCGCGCGTGTGGGAGGG AGG Intergenic