ID: 1137853976

View in Genome Browser
Species Human (GRCh38)
Location 16:51774805-51774827
Sequence AAGAGAACCCTAATGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853976_1137853982 11 Left 1137853976 16:51774805-51774827 CCTACCTGCATTAGGGTTCTCTT No data
Right 1137853982 16:51774839-51774861 ATAGGAGATATATATGTAAAGGG No data
1137853976_1137853980 -7 Left 1137853976 16:51774805-51774827 CCTACCTGCATTAGGGTTCTCTT No data
Right 1137853980 16:51774821-51774843 TTCTCTTCGAGGGAAAAAATAGG No data
1137853976_1137853983 12 Left 1137853976 16:51774805-51774827 CCTACCTGCATTAGGGTTCTCTT No data
Right 1137853983 16:51774840-51774862 TAGGAGATATATATGTAAAGGGG No data
1137853976_1137853981 10 Left 1137853976 16:51774805-51774827 CCTACCTGCATTAGGGTTCTCTT No data
Right 1137853981 16:51774838-51774860 AATAGGAGATATATATGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853976 Original CRISPR AAGAGAACCCTAATGCAGGT AGG (reversed) Intergenic