ID: 1137853977

View in Genome Browser
Species Human (GRCh38)
Location 16:51774809-51774831
Sequence CTCGAAGAGAACCCTAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853977_1137853981 6 Left 1137853977 16:51774809-51774831 CCTGCATTAGGGTTCTCTTCGAG No data
Right 1137853981 16:51774838-51774860 AATAGGAGATATATATGTAAAGG No data
1137853977_1137853982 7 Left 1137853977 16:51774809-51774831 CCTGCATTAGGGTTCTCTTCGAG No data
Right 1137853982 16:51774839-51774861 ATAGGAGATATATATGTAAAGGG No data
1137853977_1137853983 8 Left 1137853977 16:51774809-51774831 CCTGCATTAGGGTTCTCTTCGAG No data
Right 1137853983 16:51774840-51774862 TAGGAGATATATATGTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853977 Original CRISPR CTCGAAGAGAACCCTAATGC AGG (reversed) Intergenic