ID: 1137853983

View in Genome Browser
Species Human (GRCh38)
Location 16:51774840-51774862
Sequence TAGGAGATATATATGTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137853977_1137853983 8 Left 1137853977 16:51774809-51774831 CCTGCATTAGGGTTCTCTTCGAG No data
Right 1137853983 16:51774840-51774862 TAGGAGATATATATGTAAAGGGG No data
1137853976_1137853983 12 Left 1137853976 16:51774805-51774827 CCTACCTGCATTAGGGTTCTCTT No data
Right 1137853983 16:51774840-51774862 TAGGAGATATATATGTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137853983 Original CRISPR TAGGAGATATATATGTAAAG GGG Intergenic
No off target data available for this crispr