ID: 1137855751

View in Genome Browser
Species Human (GRCh38)
Location 16:51792927-51792949
Sequence GCGCGCGCGCGCCCTAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137855751_1137855755 30 Left 1137855751 16:51792927-51792949 CCCTTCCTAGGGCGCGCGCGCGC No data
Right 1137855755 16:51792980-51793002 ACACACACACACACTAGGTCTGG No data
1137855751_1137855754 25 Left 1137855751 16:51792927-51792949 CCCTTCCTAGGGCGCGCGCGCGC No data
Right 1137855754 16:51792975-51792997 CACACACACACACACACACTAGG 0: 140
1: 2667
2: 2640
3: 3867
4: 6626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137855751 Original CRISPR GCGCGCGCGCGCCCTAGGAA GGG (reversed) Intergenic
No off target data available for this crispr