ID: 1137861958

View in Genome Browser
Species Human (GRCh38)
Location 16:51855815-51855837
Sequence CACCTGTTCTAGATAACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137861954_1137861958 16 Left 1137861954 16:51855776-51855798 CCCAAGCTGATGGGGATTTACTG No data
Right 1137861958 16:51855815-51855837 CACCTGTTCTAGATAACAAGTGG No data
1137861955_1137861958 15 Left 1137861955 16:51855777-51855799 CCAAGCTGATGGGGATTTACTGA No data
Right 1137861958 16:51855815-51855837 CACCTGTTCTAGATAACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137861958 Original CRISPR CACCTGTTCTAGATAACAAG TGG Intergenic
No off target data available for this crispr