ID: 1137862341

View in Genome Browser
Species Human (GRCh38)
Location 16:51858679-51858701
Sequence AGGTACACAGGGAAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137862328_1137862341 14 Left 1137862328 16:51858642-51858664 CCCCCTATGTGGGTGGAGCAGCT No data
Right 1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG No data
1137862324_1137862341 30 Left 1137862324 16:51858626-51858648 CCAAATAATCATCTTTCCCCCTA No data
Right 1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG No data
1137862329_1137862341 13 Left 1137862329 16:51858643-51858665 CCCCTATGTGGGTGGAGCAGCTG No data
Right 1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG No data
1137862331_1137862341 11 Left 1137862331 16:51858645-51858667 CCTATGTGGGTGGAGCAGCTGAC No data
Right 1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG No data
1137862330_1137862341 12 Left 1137862330 16:51858644-51858666 CCCTATGTGGGTGGAGCAGCTGA No data
Right 1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137862341 Original CRISPR AGGTACACAGGGAAGGGACA GGG Intergenic
No off target data available for this crispr