ID: 1137863296

View in Genome Browser
Species Human (GRCh38)
Location 16:51868389-51868411
Sequence TACCCAAGGCTGCTAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137863293_1137863296 -4 Left 1137863293 16:51868370-51868392 CCTTTCTCTTTCCGGTCTGTACC No data
Right 1137863296 16:51868389-51868411 TACCCAAGGCTGCTAAACCCTGG No data
1137863291_1137863296 20 Left 1137863291 16:51868346-51868368 CCTAATATTGTGCTGGCTTCTCT No data
Right 1137863296 16:51868389-51868411 TACCCAAGGCTGCTAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137863296 Original CRISPR TACCCAAGGCTGCTAAACCC TGG Intergenic
No off target data available for this crispr