ID: 1137870063

View in Genome Browser
Species Human (GRCh38)
Location 16:51941246-51941268
Sequence TGTTAATTATAGTCACCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137870063_1137870064 21 Left 1137870063 16:51941246-51941268 CCATAGGGTGACTATAATTAACA No data
Right 1137870064 16:51941290-51941312 AATAGACAGAAGAATATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137870063 Original CRISPR TGTTAATTATAGTCACCCTA TGG (reversed) Intergenic
No off target data available for this crispr