ID: 1137870507

View in Genome Browser
Species Human (GRCh38)
Location 16:51945825-51945847
Sequence TGGAGTTAATGCAACCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137870505_1137870507 -1 Left 1137870505 16:51945803-51945825 CCTTCTGTGCACAGAACAATTCT No data
Right 1137870507 16:51945825-51945847 TGGAGTTAATGCAACCCCGAAGG No data
1137870504_1137870507 0 Left 1137870504 16:51945802-51945824 CCCTTCTGTGCACAGAACAATTC No data
Right 1137870507 16:51945825-51945847 TGGAGTTAATGCAACCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137870507 Original CRISPR TGGAGTTAATGCAACCCCGA AGG Intergenic
No off target data available for this crispr