ID: 1137875208

View in Genome Browser
Species Human (GRCh38)
Location 16:51990081-51990103
Sequence CCCCTAAGGCATCCGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137875202_1137875208 8 Left 1137875202 16:51990050-51990072 CCAAAGTCATGCTGGGACCTGCT No data
Right 1137875208 16:51990081-51990103 CCCCTAAGGCATCCGTGGACTGG No data
1137875200_1137875208 15 Left 1137875200 16:51990043-51990065 CCAAACTCCAAAGTCATGCTGGG No data
Right 1137875208 16:51990081-51990103 CCCCTAAGGCATCCGTGGACTGG No data
1137875203_1137875208 -9 Left 1137875203 16:51990067-51990089 CCTGCTTCATTCCTCCCCTAAGG No data
Right 1137875208 16:51990081-51990103 CCCCTAAGGCATCCGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137875208 Original CRISPR CCCCTAAGGCATCCGTGGAC TGG Intergenic
No off target data available for this crispr