ID: 1137879886

View in Genome Browser
Species Human (GRCh38)
Location 16:52034996-52035018
Sequence TTGGAGGTACAGCTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137879886_1137879899 20 Left 1137879886 16:52034996-52035018 CCCTGTTCCAGCTGTACCTCCAA 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1137879899 16:52035039-52035061 CTCTTTCCACTATTCTCACCAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1137879886_1137879901 26 Left 1137879886 16:52034996-52035018 CCCTGTTCCAGCTGTACCTCCAA 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1137879901 16:52035045-52035067 CCACTATTCTCACCAGGCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137879886 Original CRISPR TTGGAGGTACAGCTGGAACA GGG (reversed) Intronic
900218450 1:1494710-1494732 TGGGAGGTACAGCTGGGACGGGG + Intronic
900225792 1:1533133-1533155 TGGGAGGTACAGCTGGGACGGGG + Intronic
901546878 1:9964485-9964507 TGGGAGGTTTAGCTTGAACATGG - Intronic
902776657 1:18679259-18679281 TTGGAGGTGGAGATGGAAAATGG - Intronic
903334647 1:22616822-22616844 TTGGAGCTAGAGCTGTGACAGGG + Intergenic
906107515 1:43303828-43303850 TGGGAGGTACAGTTGGAGCAGGG - Intronic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908896560 1:68907494-68907516 TTTCAGATACAGCTGGAACCAGG - Intergenic
910922166 1:92359846-92359868 TTTGTGGGACAGCTGGATCAAGG + Intronic
911268161 1:95767956-95767978 TTGGTGGTCCAGCTGAAATATGG + Intergenic
911903162 1:103530426-103530448 TTAGAGGAACAGCTGGAACAGGG + Intronic
913180984 1:116321267-116321289 GTGGTGGTACAGTTGTAACAGGG - Intergenic
915484838 1:156212997-156213019 TTGGAGGTTCAACTTCAACATGG + Exonic
915836194 1:159177507-159177529 TTGGAGGTAAAACAGGACCATGG - Intronic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
917647796 1:177046198-177046220 TTGGAGTTACAGCTGGTGCCAGG - Intronic
918638379 1:186807782-186807804 TTGGAGTAGCAGCTGGCACATGG + Intergenic
918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG + Intergenic
921625664 1:217375122-217375144 TTGAAGTTCCAACTGGAACATGG - Intergenic
922977920 1:229800659-229800681 TTGGAGGGGCAGCAGGAACAGGG + Intergenic
924284438 1:242471164-242471186 GGGTAGGTGCAGCTGGAACAGGG - Intronic
1064148842 10:12846409-12846431 TTGGAGGAACTGTTTGAACATGG - Intergenic
1065286937 10:24195361-24195383 TTTGGGCTTCAGCTGGAACAAGG - Intronic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1065551011 10:26868618-26868640 TTGGAAGGACAGCAGGAACCTGG + Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1074533607 10:114313205-114313227 TTGGAGGTCCCTCTGGAACTGGG + Intronic
1075778517 10:125002871-125002893 TTGGAGAAGCAGCTGGAACTGGG - Intronic
1077131739 11:976427-976449 GTGGAGGCACAGCTGAAAAAGGG - Intronic
1078079843 11:8195953-8195975 TTGGGGGTACAGGGGTAACAGGG + Intergenic
1079300528 11:19275243-19275265 TTCGAGGTACACCTGGTCCAGGG - Intergenic
1079433734 11:20423416-20423438 TTGTAAGTAAAGCTGGAACACGG + Intronic
1079885498 11:25983380-25983402 TTGGAGCTTCATCTGTAACATGG - Intergenic
1081083248 11:38768954-38768976 TTGGAGGTACAGTGGGAAGAGGG - Intergenic
1081953454 11:47067424-47067446 TTGGAGGTATGGCTTCAACATGG - Intronic
1082811388 11:57481240-57481262 TTGGAAGAAAAGCTGGAAGAGGG - Intergenic
1082816761 11:57514591-57514613 TTGGAGGGGCAACTGGAAGATGG - Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1084045104 11:66563832-66563854 CGGGAGGTACAGCTGGCAGAGGG - Exonic
1086194397 11:84119989-84120011 TTGGAGGTATGGCTGGAAGGAGG + Intronic
1086420214 11:86631084-86631106 TTGGAGGAACTGCTGGATTAGGG + Intronic
1088315238 11:108499522-108499544 TTTGAGGTAAAGCTCGCACAAGG - Intergenic
1089446606 11:118557815-118557837 TTGCAGGGGCAGGTGGAACAGGG + Exonic
1091970087 12:4779660-4779682 CTGGAGGTGCAGCTGCCACAGGG + Intronic
1092891706 12:12975206-12975228 TTGGACTTGCAGCTGGAACTTGG + Exonic
1096098494 12:48954203-48954225 TGGGAGGTGAAGCTGGAGCAAGG - Intronic
1101137934 12:101764755-101764777 TTGGATTTGCAACTGGAACATGG - Exonic
1101674259 12:106903414-106903436 TGGGTGGTCCAGCTGGACCATGG - Intergenic
1102458946 12:113088133-113088155 TTGGTGGTGCAGCTGGCACTGGG - Intronic
1102570164 12:113822647-113822669 CTGGAGGGAGAGCAGGAACAGGG + Intronic
1103757220 12:123218094-123218116 GTGGTGGTACAGGTGGTACATGG - Intronic
1105865460 13:24454836-24454858 TGAGTGGTACAGCTGGAACCGGG + Intronic
1108245640 13:48510407-48510429 TTGGAGGTATAGATGAAACATGG + Intronic
1109641164 13:65193359-65193381 TGGGAAGTACAGCAGGAATATGG - Intergenic
1112596418 13:100811867-100811889 TGTGATGTACAGCTGTAACAAGG + Intergenic
1112929012 13:104712789-104712811 TTTGAGTTACTGCTAGAACAAGG - Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1117295594 14:54376452-54376474 TTGGAGCTTCAGCTGGAACTGGG - Intergenic
1117974588 14:61284496-61284518 TTGGAGGTGAAGCTGTACCAAGG + Intronic
1118752663 14:68817977-68817999 TTGGAGAAACAGCTGGATCCTGG - Intergenic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1120543613 14:85782167-85782189 TTGGAGATGAAGCTGGAATATGG - Intergenic
1120628680 14:86861272-86861294 TTGGAGGTATGGCTGGAACTGGG - Intergenic
1120723852 14:87916470-87916492 ATGGAGGTACAGCGGGAGAAAGG + Intronic
1122479713 14:102039181-102039203 CGGGAGGTACTGCTGGGACACGG - Exonic
1123922008 15:25076833-25076855 TGGGAGGTACAGATGAAACATGG - Intergenic
1127651081 15:61008388-61008410 TTGTGGGTGCAGCTGGAATATGG - Intronic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1130876882 15:88022266-88022288 TTGGATGTACAGATAGAACTTGG - Intronic
1131720590 15:95164316-95164338 TGGTATGTACAGCTGGAAAATGG - Intergenic
1134072833 16:11271561-11271583 TTAGAGGGACAGCTGCAGCAGGG + Intronic
1134276455 16:12780661-12780683 TTGCAGGTACAGCTGGATCTAGG - Intronic
1134422887 16:14111194-14111216 TTGGAGGTGCAGGTGGTAGAGGG + Intronic
1136609027 16:31355192-31355214 TTGCAGGAAGAGCTGGACCAAGG - Intronic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1142528526 17:562541-562563 TCGGAGGTACTTCTGGAAAATGG + Exonic
1144379095 17:14675249-14675271 TTGGCTTTACAGCTTGAACAAGG - Intergenic
1145746765 17:27325626-27325648 CTGGAGGGCCAGCTGGATCATGG - Intergenic
1146001544 17:29133443-29133465 GTGGAGGGACCGCTGGAACTGGG - Intronic
1148018005 17:44536254-44536276 TTAGAAATACAGCTGGAACCTGG - Intergenic
1148131768 17:45266582-45266604 TCGAAGCTCCAGCTGGAACATGG - Exonic
1150857065 17:68763416-68763438 TTTCAGGTACAGTTGGAACATGG - Intergenic
1151932670 17:77242332-77242354 TTGGAGGAACAGCTTGAACTAGG + Intergenic
1152218750 17:79049390-79049412 TTGCAGGACCAGCTGGAGCAGGG + Exonic
1156473007 18:37389129-37389151 TTGGAGATGCACCTGAAACATGG + Intronic
1156765427 18:40648460-40648482 ATAGAGGTGAAGCTGGAACATGG + Intergenic
1157722485 18:49936191-49936213 TTAGAGGTTCAGGTGGAACAGGG - Intronic
1158320245 18:56254252-56254274 TTGGAGGTACAAGAAGAACAAGG + Intergenic
1158653127 18:59305506-59305528 CTGGACGTGCAGCTGGAGCAGGG + Intronic
1158699708 18:59735075-59735097 TTGGAGGTAGAGCCAGAACGTGG - Intergenic
1160160248 18:76465295-76465317 TGGCAGTTACAGGTGGAACAGGG + Intronic
1161454303 19:4362478-4362500 TTGGCGGTCCAGATGGAGCACGG + Intronic
1161588510 19:5118199-5118221 TTGGAGGGGCAGCTGCCACAGGG + Intronic
1163229270 19:15989085-15989107 TGGGGGGTACAGGTGGTACATGG + Intergenic
1163257930 19:16168795-16168817 TGTCAGGTACAGCTGGAACCAGG - Intronic
1163332106 19:16646216-16646238 TTGGAGGTAAACCTGGAGGAAGG - Exonic
928870231 2:35967088-35967110 TTAGAGGTACTCCTGGAACTGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
930902478 2:56524575-56524597 TTGGAGGTCCATGTGGAAGAGGG + Intergenic
932091892 2:68813313-68813335 TCGGAGGTAGAGCTTTAACAGGG - Exonic
932588216 2:73045451-73045473 AAGTAGGTACAGCTGAAACATGG + Intronic
932615627 2:73229525-73229547 CTGGAGGTTCAGCGGGGACAAGG + Exonic
935051368 2:99527843-99527865 TTGGAGGTCAAGCTGGCTCATGG + Intergenic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
941138624 2:161747797-161747819 TTGAATGTACACCTGGAAGAGGG + Intronic
942025681 2:171908359-171908381 TATGAGGTACAGGTGGAATAAGG - Intronic
948708526 2:239810757-239810779 TTGGAGCTAGAGCTGGGACCAGG - Intergenic
1168890689 20:1293847-1293869 TGGCAGGGACAGCTGGGACAAGG + Intronic
1170147443 20:13192234-13192256 TTGGAGGTACATAAAGAACAGGG + Intergenic
1171299266 20:24045480-24045502 TTAGAGGCAAAGCTGGAAAAGGG - Intergenic
1172630495 20:36375125-36375147 TTGGAGGCAGGGCTGGGACATGG + Intronic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174657870 20:52186815-52186837 TCACAGGTACAGCTGGAGCATGG - Exonic
1175331155 20:58165350-58165372 TTTCAGGTACAGCTTGATCAGGG + Intergenic
1176699814 21:10032187-10032209 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1179838436 21:44053744-44053766 CTGGAGGCACATGTGGAACAAGG - Intronic
1180954142 22:19733930-19733952 TGGCAGGTACAGCTGCCACATGG - Intergenic
1184308256 22:43623969-43623991 TTGGTGGTGGAGGTGGAACAGGG + Intronic
1185131924 22:49044206-49044228 GTGGAGGAGCAGCTGAAACAGGG - Intergenic
950632884 3:14294961-14294983 TTAGAGGTAGAGCTTGAAGATGG + Intergenic
950686813 3:14624373-14624395 TTGTAGGGACAACTGGAAGAGGG + Intergenic
950904719 3:16527660-16527682 TTGGTGATACAGCTGGAAATGGG + Intergenic
952768520 3:36976471-36976493 CTGGAGGTTCAGCAGGGACAAGG - Intergenic
960307418 3:116078847-116078869 TTGGAGAAACAGCTGGTACCAGG - Intronic
960524604 3:118695339-118695361 ATGGAGGTACTGCTGGAAGTGGG - Intergenic
963753692 3:149210865-149210887 GTGGGGGTACAGATGAAACAAGG - Intronic
967723742 3:192842228-192842250 TGGGAAGTACGGCAGGAACATGG + Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
975217298 4:71770308-71770330 TTGGGGGTAGAGCTGGGACTGGG - Intronic
979673114 4:123382342-123382364 TTAGAGGTAAAGCTTGAATAAGG + Intergenic
980372226 4:131890797-131890819 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
985749377 5:1665680-1665702 GTGGAGGTCCAGGTAGAACATGG + Intergenic
989172450 5:38486120-38486142 GTGGGGGTAGAGCTTGAACAAGG - Intronic
990957707 5:61360206-61360228 TTGGAGGTATCGCTAGAACCAGG + Intronic
991122844 5:63035315-63035337 CTGGAGGTACAGCTGACCCAGGG - Intergenic
992254063 5:74904111-74904133 TTGGAGCTGCAGTGGGAACAGGG + Intergenic
993924173 5:93844974-93844996 TAGGAGGTACAGGTAGACCATGG + Intronic
994010318 5:94894767-94894789 CTGGAGTTGCAGCTGGAAGAGGG - Exonic
995573581 5:113506710-113506732 GTGGAGGTACACCTGGGTCAAGG + Intergenic
995663453 5:114512579-114512601 TTGGAGGTGCAGGTGGGAGAAGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996318990 5:122192697-122192719 TCAGAGGAACAGCTGGAGCAGGG + Intergenic
996692257 5:126352763-126352785 CAGCAGGTACAGCTGGCACATGG - Intergenic
998892116 5:146757262-146757284 TTAGAAGTAGAGCGGGAACATGG + Intronic
999339477 5:150757592-150757614 CTGGAGGTGGAGCTGGAATAGGG + Intronic
999754961 5:154657430-154657452 TTGGGTCTCCAGCTGGAACAAGG - Intergenic
1003690735 6:8351375-8351397 CTGGAGGTACTGCAGGGACACGG + Intergenic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1006169624 6:32085575-32085597 TTGCAGGTTCAGCAGGAAGATGG - Intronic
1007124180 6:39411128-39411150 TTTCAGGTACAGCTGGGACCAGG + Intronic
1007701553 6:43769156-43769178 TTGGGGGGGCAGCAGGAACAAGG + Intergenic
1011162132 6:84403295-84403317 TTGGAGGTCCAGAAGGAACTTGG + Intergenic
1013707080 6:112849309-112849331 TGGGTGGGACATCTGGAACAGGG + Intergenic
1013964118 6:115935189-115935211 ATGGAGGGCCAGCTGAAACAGGG + Exonic
1015028003 6:128560456-128560478 TTGGGGGAACAGCAGGAACCAGG + Intergenic
1018441988 6:163821952-163821974 TGGGAGTGACAGCTGGAACATGG + Intergenic
1018522545 6:164666679-164666701 TTCCATGTACAGCTGGAACCTGG + Intergenic
1019156025 6:170039545-170039567 ATGGAGGGACAGCAGGGACACGG - Intergenic
1021595745 7:22314827-22314849 TTTAAAGTACAGCTGGACCAAGG - Intronic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1024137021 7:46419724-46419746 TTGGAGATACAGCAATAACAGGG + Intergenic
1024181626 7:46901105-46901127 TTAGAGAGACAGCTGGAACCTGG + Intergenic
1024434415 7:49332951-49332973 TTAAAGGTGCAGCTGGAACAGGG + Intergenic
1026987150 7:74561755-74561777 TGGGAGGTCCTGCTGGGACAAGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031345307 7:120658248-120658270 TTGAAAATACAGCAGGAACAGGG - Intronic
1031533031 7:122899362-122899384 TTGGTGCTATAGATGGAACAAGG + Intergenic
1032873930 7:136017046-136017068 TTACAGGTTCACCTGGAACATGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1038976130 8:32698298-32698320 TTCAAGGAACAGCTGGAAAATGG + Intronic
1040538107 8:48327162-48327184 TTGTAGGAAGAGCTGGACCAGGG + Intergenic
1043335853 8:79175928-79175950 TTGGAGACTCAGCTGGAACCTGG + Intergenic
1045017637 8:98012742-98012764 GTGGATGTGCAGCTGGACCAGGG + Intronic
1045772831 8:105764227-105764249 TTGGTGGTAAAGCTAGATCAAGG + Intronic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1048515191 8:135101822-135101844 TTGGATGTACACCCAGAACAGGG + Intergenic
1049575581 8:143388388-143388410 CTGGAGGTGCAGCGGGAACCAGG - Intergenic
1050427005 9:5521902-5521924 TGGGAGGTACAGCAGGACCAAGG + Intronic
1050532925 9:6606484-6606506 TTGGAGGTGAATCTGAAACAGGG - Intronic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1053636963 9:40018656-40018678 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1053769066 9:41446246-41446268 TGTGAGGTACAGGTGGAGCAAGG - Intergenic
1054317792 9:63615449-63615471 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1054547737 9:66357747-66357769 TGTGAGGTACAGGTGGAGCAAGG - Intergenic
1056766792 9:89449002-89449024 TTCAGGGTACAGCTGGGACATGG + Intronic
1057164874 9:92917549-92917571 TTGGAGCTGGAGCAGGAACAAGG - Intergenic
1057367965 9:94441718-94441740 TTGGACATACATTTGGAACATGG + Intronic
1058683815 9:107463698-107463720 TTTGAGGTTCATCTGGAAAATGG + Intergenic
1058752889 9:108056222-108056244 TTAGAGGTAAAGCTGGACCTGGG + Intergenic
1060523411 9:124307454-124307476 GTGGAGGAACCGCTGGAACAAGG - Intronic
1060542363 9:124439599-124439621 CTGGAGGAACAGCCGAAACATGG + Intergenic
1060880914 9:127117455-127117477 CTGGAGGTAGAACAGGAACAAGG + Intronic
1202784827 9_KI270719v1_random:2246-2268 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1190364207 X:49676418-49676440 TTGGGGGTACAGCTGGATCCAGG + Intergenic
1190932254 X:54959020-54959042 ATGGAGGTAGAACTTGAACAAGG + Intronic
1191055957 X:56241068-56241090 GTTGAGGTACAGATGAAACAAGG + Intronic
1193258738 X:79380246-79380268 TTGGAGTTTCAGCTGGACAATGG + Intergenic
1193619820 X:83738100-83738122 TTGGAGGTAGCCCTGAAACAAGG - Intergenic
1195480277 X:105337120-105337142 TTGAAGATACAGCAGAAACATGG - Intronic
1195618387 X:106930514-106930536 TTGGGAGAGCAGCTGGAACATGG - Exonic
1195902931 X:109817518-109817540 TTGGAGGTGCAGAGGGGACAAGG + Intergenic
1196760276 X:119194639-119194661 TTGCACTTACAGCTGGACCATGG + Intergenic
1197149649 X:123206156-123206178 TTGAAATTACAGGTGGAACAAGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic