ID: 1137883072

View in Genome Browser
Species Human (GRCh38)
Location 16:52072844-52072866
Sequence TACCCAGGACAACCACTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137883072_1137883075 6 Left 1137883072 16:52072844-52072866 CCTGGTAGTGGTTGTCCTGGGTA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1137883075 16:52072873-52072895 AGATTAGTGTCCACATAAAAAGG 0: 1
1: 1
2: 8
3: 118
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137883072 Original CRISPR TACCCAGGACAACCACTACC AGG (reversed) Intronic
900320289 1:2080121-2080143 GTCCCAGGGCATCCACTACCCGG + Intronic
903166427 1:21523689-21523711 TGCCCAGGACAAGCAGTAACAGG + Intronic
903993795 1:27292314-27292336 CCCCCAGGACAACAACTGCCTGG + Exonic
907983639 1:59509042-59509064 CTCCCAGGACAGCCAGTACCTGG - Intronic
908155872 1:61352546-61352568 TACCCAGCACATCCTCTACGAGG + Exonic
909874910 1:80789671-80789693 TACCTAGGAATACAACTACCTGG + Intergenic
910159809 1:84260628-84260650 TCCCCAGGACTAGGACTACCTGG + Intergenic
916673223 1:167043826-167043848 CACCCTGGACAACCTCTAGCAGG + Intergenic
916678672 1:167085356-167085378 TAGCCAGGTCAAACACTGCCAGG + Intronic
917387179 1:174490555-174490577 GGCCCAGTATAACCACTACCAGG + Intronic
924442463 1:244097642-244097664 TCCCCAGGACAAACCCTACCTGG - Intergenic
1064009375 10:11723192-11723214 TACCCAGCAACACCACTTCCAGG + Intergenic
1067082875 10:43221526-43221548 TACCCAGGGCAACCAGCACAGGG + Intronic
1067794492 10:49311047-49311069 TCCCCAGGACCACCAAGACCCGG + Intronic
1069811765 10:71165907-71165929 AACCCAGGAAACCCATTACCAGG + Intergenic
1070503985 10:77097135-77097157 TAGCCAAGAAAAGCACTACCAGG - Intronic
1075054177 10:119206141-119206163 TACCCACCACCACCACTTCCTGG - Intergenic
1076347132 10:129786932-129786954 TGCCCAGCACACCCACTACCTGG - Intergenic
1077702129 11:4452490-4452512 AACCCAGGAGAACCATTTCCAGG - Intergenic
1089164846 11:116467929-116467951 TACCCAAGACAACCTCCTCCGGG - Intergenic
1089993131 11:122880454-122880476 TACTCAGGACAGCCATTACAAGG + Intergenic
1093419938 12:18964088-18964110 AACCCACTATAACCACTACCTGG + Intergenic
1093774011 12:23051404-23051426 CACCCAGGAAAAACACTATCAGG - Intergenic
1097249864 12:57626575-57626597 TCACCAGGACAACCCCTACTGGG + Exonic
1097587018 12:61527389-61527411 CACCCAGGAGAACCATCACCAGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101829505 12:108246386-108246408 TCACAAGGACAAACACTACCCGG - Intronic
1102681627 12:114694494-114694516 TACTCAGGAGACCCATTACCAGG + Intergenic
1109910318 13:68902508-68902530 TACCCAGCAAACCCACTACTAGG - Intergenic
1118985644 14:70752516-70752538 TCCCCAGCATGACCACTACCTGG - Intronic
1126262378 15:46709127-46709149 TACCAAAGACACTCACTACCGGG + Intergenic
1126428196 15:48552018-48552040 GACCCAGCAATACCACTACCGGG - Intronic
1135345160 16:21682875-21682897 GTCCCAGGACAGCCACTAGCTGG + Intronic
1137883072 16:52072844-52072866 TACCCAGGACAACCACTACCAGG - Intronic
1144421283 17:15101430-15101452 TTCCCAGAACAAACACAACCTGG - Intergenic
1151361305 17:73590755-73590777 TACCCTTAACAACCTCTACCTGG - Intronic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1154112821 18:11585127-11585149 AACCCAGGAGAACCATTTCCAGG - Intergenic
1157130656 18:45004288-45004310 TGCCAAGGACAACATCTACCTGG - Intronic
1157675525 18:49565793-49565815 TACGCTGGTCAACCACTGCCTGG + Intronic
1159446412 18:68545890-68545912 GACCCATGACAACCACTGCCTGG - Intergenic
1160281890 18:77498868-77498890 TACCTAGAACCACCAGTACCTGG - Intergenic
1161435595 19:4260881-4260903 TACCCAGGACAACATCCATCTGG + Intronic
1162622327 19:11853557-11853579 TACTGAGGACAATCACTCCCTGG - Intronic
933225375 2:79742515-79742537 TCCCCAGAACAGCCAATACCTGG - Intronic
938022545 2:127917899-127917921 CACCCAGGACACCCACAACATGG + Intergenic
945055841 2:205868377-205868399 TACCCCCCACAACCACCACCCGG + Intergenic
945162388 2:206905987-206906009 GGCCCATGGCAACCACTACCTGG + Intergenic
1171479711 20:25444786-25444808 GACACAGGACAAGCAATACCTGG + Intronic
1172532845 20:35645405-35645427 TGGCCAGGAAAGCCACTACCTGG + Intronic
1179499916 21:41801704-41801726 CACCCAGGGTCACCACTACCTGG + Exonic
950696502 3:14704728-14704750 TACCCAGGAGACCCATCACCAGG - Intronic
951548090 3:23849128-23849150 GACCCAGCAAAACCACTCCCAGG - Intronic
952056657 3:29454541-29454563 CACCCAGGACAAGCACCAACAGG + Intronic
952627726 3:35427153-35427175 GACCCAGGAATCCCACTACCAGG + Intergenic
954391100 3:50268283-50268305 TACCCAGGAGACCCAAGACCTGG - Intronic
958730041 3:97951785-97951807 TTCCCAAGACATCTACTACCTGG + Intronic
968877519 4:3280805-3280827 TCCCCAGGGCAGACACTACCTGG + Intergenic
969559909 4:7940084-7940106 TACCCAGCTCAACGTCTACCTGG + Exonic
971209261 4:24600229-24600251 TCCCCAGGACAAACCGTACCTGG - Intergenic
974159382 4:58118363-58118385 TACCTAGGAGATCCAGTACCAGG - Intergenic
981691967 4:147519003-147519025 TACCCAGCACAGCCACTAGAGGG + Intronic
982202559 4:152974668-152974690 CCCTCAGGACAACCACGACCGGG + Exonic
982887634 4:160802110-160802132 TATCCAGGAATCCCACTACCAGG + Intergenic
989158032 5:38363254-38363276 TACCCAGGGCAAACACAACAGGG - Intronic
989506224 5:42230069-42230091 AACCCAGGAGAACCATTTCCAGG + Intergenic
991176255 5:63690367-63690389 TCCCCAGGACAAACCATACCAGG + Intergenic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
994080110 5:95699106-95699128 TACCCAGCAGAACCTCAACCTGG - Intergenic
996301352 5:121990052-121990074 AACCCAGGAATACCACTACTGGG + Intronic
1003562665 6:7195772-7195794 TTCCCAGGACACCCACACCCAGG + Intronic
1005135863 6:22569671-22569693 GACCCAGCCCAACCGCTACCAGG + Exonic
1012405019 6:98886096-98886118 TACCCAGCTAAACCACTCCCAGG + Intronic
1015505370 6:133980364-133980386 TATCCAGGACAACCAGCACATGG - Intronic
1017034462 6:150254643-150254665 TCCACAGAACAACCACTTCCAGG - Intergenic
1017964853 6:159255290-159255312 TGCCCAGGATTCCCACTACCTGG + Intronic
1022504611 7:30902526-30902548 TCCTCAGGCCAACCACTCCCAGG - Intergenic
1028521905 7:91741738-91741760 GACCCACTATAACCACTACCTGG + Intronic
1037032374 8:14125064-14125086 TACCAAGGAATACCACTAACAGG + Intronic
1037768178 8:21784449-21784471 TACCCAGAACAGCCACTCTCAGG + Intronic
1038207381 8:25479575-25479597 TACTCATGACACCCACTACTTGG - Intronic
1038578941 8:28730215-28730237 TACTGAGAACAACCTCTACCTGG - Intronic
1042823168 8:72953786-72953808 CACCCAAATCAACCACTACCAGG + Intergenic
1046054218 8:109060050-109060072 TACCCAGCACAATAAATACCAGG + Intergenic
1046150071 8:110211974-110211996 TGCCCACCATAACCACTACCTGG - Intergenic
1051811578 9:21055319-21055341 TTCCCACAACAACCTCTACCTGG - Intergenic
1051854858 9:21552469-21552491 TATCCAGGTGAAGCACTACCGGG - Intergenic
1056260685 9:84845086-84845108 GATCCAGCACTACCACTACCAGG + Intronic
1060533040 9:124359803-124359825 TACCCAAGACTACCACTTCAAGG + Intronic
1061400975 9:130368269-130368291 CACCCAGGTCAACCCCTCCCCGG + Intronic
1061510829 9:131059959-131059981 TAACCAAGACCACCACTTCCAGG - Intronic
1061806913 9:133141894-133141916 TACCCAGCCCAACCACAACCTGG + Intronic
1191104495 X:56764169-56764191 AACCCAGGACCAGCAGTACCTGG - Intergenic
1196855664 X:119981354-119981376 TACCCAGGACACTAACTACTTGG + Intergenic
1198546845 X:137701516-137701538 TTTCCAGGACAAACACTGCCTGG - Intergenic