ID: 1137884377

View in Genome Browser
Species Human (GRCh38)
Location 16:52086812-52086834
Sequence CCTTCTCTCTGCATTCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137884377_1137884381 -7 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884381 16:52086828-52086850 GAGAAGGCATAAGGACATAAGGG No data
1137884377_1137884384 2 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884384 16:52086837-52086859 TAAGGACATAAGGGAGGTGGTGG No data
1137884377_1137884380 -8 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884380 16:52086827-52086849 AGAGAAGGCATAAGGACATAAGG No data
1137884377_1137884383 -1 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884383 16:52086834-52086856 GCATAAGGACATAAGGGAGGTGG No data
1137884377_1137884385 7 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884385 16:52086842-52086864 ACATAAGGGAGGTGGTGGCCTGG No data
1137884377_1137884382 -4 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884382 16:52086831-52086853 AAGGCATAAGGACATAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137884377 Original CRISPR CCTTCTCTCTGCATTCCTCA AGG (reversed) Intergenic
No off target data available for this crispr