ID: 1137884383

View in Genome Browser
Species Human (GRCh38)
Location 16:52086834-52086856
Sequence GCATAAGGACATAAGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137884377_1137884383 -1 Left 1137884377 16:52086812-52086834 CCTTGAGGAATGCAGAGAGAAGG No data
Right 1137884383 16:52086834-52086856 GCATAAGGACATAAGGGAGGTGG No data
1137884375_1137884383 20 Left 1137884375 16:52086791-52086813 CCATGAGAAAGCAACTCAAATCC No data
Right 1137884383 16:52086834-52086856 GCATAAGGACATAAGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137884383 Original CRISPR GCATAAGGACATAAGGGAGG TGG Intergenic
No off target data available for this crispr