ID: 1137884396

View in Genome Browser
Species Human (GRCh38)
Location 16:52086926-52086948
Sequence CACTAGAAGCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137884391_1137884396 -1 Left 1137884391 16:52086904-52086926 CCCTGCTGTATCTGGAATGCTTC No data
Right 1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG No data
1137884388_1137884396 13 Left 1137884388 16:52086890-52086912 CCTGCCAAAGGTGTCCCTGCTGT No data
Right 1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG No data
1137884392_1137884396 -2 Left 1137884392 16:52086905-52086927 CCTGCTGTATCTGGAATGCTTCA No data
Right 1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG No data
1137884389_1137884396 9 Left 1137884389 16:52086894-52086916 CCAAAGGTGTCCCTGCTGTATCT No data
Right 1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137884396 Original CRISPR CACTAGAAGCAGAAGGAGGA GGG Intergenic
No off target data available for this crispr