ID: 1137891341

View in Genome Browser
Species Human (GRCh38)
Location 16:52165910-52165932
Sequence CAGTGCTGTCAGCACAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137891339_1137891341 -10 Left 1137891339 16:52165897-52165919 CCCAAAGTGCTTTCAGTGCTGTC No data
Right 1137891341 16:52165910-52165932 CAGTGCTGTCAGCACAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137891341 Original CRISPR CAGTGCTGTCAGCACAAGTT TGG Intergenic