ID: 1137894961

View in Genome Browser
Species Human (GRCh38)
Location 16:52201628-52201650
Sequence CATGCAGTTTGTCCTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137894954_1137894961 25 Left 1137894954 16:52201580-52201602 CCAGCTCACAGCCTTAAAAACCC No data
Right 1137894961 16:52201628-52201650 CATGCAGTTTGTCCTCAGTGAGG No data
1137894957_1137894961 14 Left 1137894957 16:52201591-52201613 CCTTAAAAACCCTGGCGGCAGAG No data
Right 1137894961 16:52201628-52201650 CATGCAGTTTGTCCTCAGTGAGG No data
1137894959_1137894961 5 Left 1137894959 16:52201600-52201622 CCCTGGCGGCAGAGAACTTGGCA No data
Right 1137894961 16:52201628-52201650 CATGCAGTTTGTCCTCAGTGAGG No data
1137894960_1137894961 4 Left 1137894960 16:52201601-52201623 CCTGGCGGCAGAGAACTTGGCAT No data
Right 1137894961 16:52201628-52201650 CATGCAGTTTGTCCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137894961 Original CRISPR CATGCAGTTTGTCCTCAGTG AGG Intergenic
No off target data available for this crispr