ID: 1137899035

View in Genome Browser
Species Human (GRCh38)
Location 16:52245212-52245234
Sequence CATCCATCAGTTATTGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137899032_1137899035 17 Left 1137899032 16:52245172-52245194 CCTCAAATTCAAGTGACAGAGCT No data
Right 1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG No data
1137899031_1137899035 18 Left 1137899031 16:52245171-52245193 CCCTCAAATTCAAGTGACAGAGC No data
Right 1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137899035 Original CRISPR CATCCATCAGTTATTGAATA AGG Intergenic
No off target data available for this crispr