ID: 1137902366

View in Genome Browser
Species Human (GRCh38)
Location 16:52282621-52282643
Sequence CTGTATGACTTTAAGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137902366_1137902372 9 Left 1137902366 16:52282621-52282643 CCTTGTACCTTAAAGTCATACAG No data
Right 1137902372 16:52282653-52282675 ATATAAACGTGAGTGGGCGAGGG No data
1137902366_1137902371 8 Left 1137902366 16:52282621-52282643 CCTTGTACCTTAAAGTCATACAG No data
Right 1137902371 16:52282652-52282674 AATATAAACGTGAGTGGGCGAGG No data
1137902366_1137902369 2 Left 1137902366 16:52282621-52282643 CCTTGTACCTTAAAGTCATACAG No data
Right 1137902369 16:52282646-52282668 GCACTCAATATAAACGTGAGTGG No data
1137902366_1137902373 13 Left 1137902366 16:52282621-52282643 CCTTGTACCTTAAAGTCATACAG No data
Right 1137902373 16:52282657-52282679 AAACGTGAGTGGGCGAGGGATGG No data
1137902366_1137902370 3 Left 1137902366 16:52282621-52282643 CCTTGTACCTTAAAGTCATACAG No data
Right 1137902370 16:52282647-52282669 CACTCAATATAAACGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137902366 Original CRISPR CTGTATGACTTTAAGGTACA AGG (reversed) Intergenic
No off target data available for this crispr