ID: 1137904835

View in Genome Browser
Species Human (GRCh38)
Location 16:52310507-52310529
Sequence CTGAACCAGGAGCAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137904830_1137904835 5 Left 1137904830 16:52310479-52310501 CCAGTGATGACAGAGAGGCGATG No data
Right 1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG No data
1137904828_1137904835 26 Left 1137904828 16:52310458-52310480 CCTCAGAGTTCTGGGTGGTGACC No data
Right 1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137904835 Original CRISPR CTGAACCAGGAGCAGGAGGC TGG Intergenic
No off target data available for this crispr