ID: 1137906106

View in Genome Browser
Species Human (GRCh38)
Location 16:52323525-52323547
Sequence GGTCCTTAGCACGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137906106_1137906109 24 Left 1137906106 16:52323525-52323547 CCTTCCAGGTCGTGCTAAGGACC No data
Right 1137906109 16:52323572-52323594 ACAACTTTTCAGCTCTAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137906106 Original CRISPR GGTCCTTAGCACGACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr