ID: 1137910813

View in Genome Browser
Species Human (GRCh38)
Location 16:52376185-52376207
Sequence CTTGAACTCAACCACCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137910813_1137910817 24 Left 1137910813 16:52376185-52376207 CCAGCATGGTGGTTGAGTTCAAG No data
Right 1137910817 16:52376232-52376254 TGGAAGCTTTGTACCTCCTAAGG No data
1137910813_1137910815 4 Left 1137910813 16:52376185-52376207 CCAGCATGGTGGTTGAGTTCAAG No data
Right 1137910815 16:52376212-52376234 AGTGTTCCAAGTAGAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137910813 Original CRISPR CTTGAACTCAACCACCATGC TGG (reversed) Intergenic
No off target data available for this crispr