ID: 1137912192

View in Genome Browser
Species Human (GRCh38)
Location 16:52388912-52388934
Sequence GTGGCGGGACACAAATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137912192_1137912201 23 Left 1137912192 16:52388912-52388934 CCATCACATTTGTGTCCCGCCAC No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data
1137912192_1137912200 22 Left 1137912192 16:52388912-52388934 CCATCACATTTGTGTCCCGCCAC No data
Right 1137912200 16:52388957-52388979 GTAGCTGCAACTCTACTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137912192 Original CRISPR GTGGCGGGACACAAATGTGA TGG (reversed) Intergenic
No off target data available for this crispr