ID: 1137912201

View in Genome Browser
Species Human (GRCh38)
Location 16:52388958-52388980
Sequence TAGCTGCAACTCTACTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137912195_1137912201 4 Left 1137912195 16:52388931-52388953 CCACATCCTTTACTCTCTCAACC No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data
1137912191_1137912201 30 Left 1137912191 16:52388905-52388927 CCTTTGTCCATCACATTTGTGTC No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data
1137912192_1137912201 23 Left 1137912192 16:52388912-52388934 CCATCACATTTGTGTCCCGCCAC No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data
1137912194_1137912201 7 Left 1137912194 16:52388928-52388950 CCGCCACATCCTTTACTCTCTCA No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data
1137912196_1137912201 -2 Left 1137912196 16:52388937-52388959 CCTTTACTCTCTCAACCCCAGTA No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data
1137912193_1137912201 8 Left 1137912193 16:52388927-52388949 CCCGCCACATCCTTTACTCTCTC No data
Right 1137912201 16:52388958-52388980 TAGCTGCAACTCTACTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137912201 Original CRISPR TAGCTGCAACTCTACTCAAA GGG Intergenic
No off target data available for this crispr