ID: 1137916975

View in Genome Browser
Species Human (GRCh38)
Location 16:52442238-52442260
Sequence GAGTCGTATCTTAAGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137916969_1137916975 20 Left 1137916969 16:52442195-52442217 CCATGAATTTCTTTGGTTATTGT 0: 1
1: 0
2: 4
3: 43
4: 530
Right 1137916975 16:52442238-52442260 GAGTCGTATCTTAAGGGGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137916975 Original CRISPR GAGTCGTATCTTAAGGGGGG AGG Intronic
906642948 1:47452420-47452442 GAGTCATACCTTGAGGGAGGGGG + Intergenic
910159153 1:84255049-84255071 GAGTCATATCATAAGAGGCGTGG + Intergenic
921900694 1:220447614-220447636 GAGTTCTACCTTAAGGAGGGTGG + Intergenic
1063630358 10:7727983-7728005 GAGCAGTAGCTTAAGGGGTGAGG - Intronic
1066501900 10:36003009-36003031 GCGTCGGATCTTTAGGTGGGTGG + Intergenic
1083988645 11:66233185-66233207 GGGGCGTATGTTTAGGGGGGTGG + Intronic
1107842209 13:44470074-44470096 GAGCCCTACCTTAAGGGGAGAGG - Intronic
1117143118 14:52810016-52810038 GAGTAGTGTCTGAAGTGGGGAGG - Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1137916975 16:52442238-52442260 GAGTCGTATCTTAAGGGGGGAGG + Intronic
1138282571 16:55783446-55783468 GGGTCCTAACTTAAGGGGGTAGG - Intergenic
1143483921 17:7242495-7242517 GTGGCGTATCTTAGCGGGGGGGG - Exonic
1167042068 19:47028259-47028281 GAGCTGTATCTTGAGGGAGGGGG + Intronic
943390592 2:187262739-187262761 GAGACATATCTTAATTGGGGTGG - Intergenic
945843019 2:214910821-214910843 CTGTGGTATCTCAAGGGGGGTGG - Intergenic
1168959776 20:1860879-1860901 GAGTCATTTCTTCAGGGGAGTGG + Intergenic
955888509 3:63625817-63625839 GAGTCATCTCTTAAGAGGAGAGG + Intergenic
956689000 3:71858792-71858814 GGGTCGTATATTAAGTGAGGCGG - Intergenic
962021745 3:131509417-131509439 AAGTACCATCTTAAGGGGGGAGG + Intergenic
975641261 4:76502420-76502442 GACTGGCATCTGAAGGGGGGTGG + Intronic
980294796 4:130898286-130898308 TAGTAGGATCTTAAGAGGGGTGG - Intergenic
998093609 5:139384632-139384654 GAGCCGTATCTGCAGGGGGTCGG - Intergenic
1002035605 5:176467022-176467044 GAGTCATCTCTGAAGGGAGGAGG + Intronic
1017939079 6:159035819-159035841 GAATCGTATATTTAGGAGGGAGG - Exonic
1019060407 6:169253597-169253619 GATTCTTAACTTAAGGTGGGTGG - Intronic
1043290549 8:78594898-78594920 GAGTCATCTCTTAAGGTAGGTGG + Intronic
1045754061 8:105521388-105521410 GAGAAATATATTAAGGGGGGAGG + Intronic
1049311973 8:141938190-141938212 GAGTCGTAACTTTAGGGTGGGGG - Intergenic
1198306781 X:135391466-135391488 GAGTGGTTTGTAAAGGGGGGAGG - Intergenic