ID: 1137917103

View in Genome Browser
Species Human (GRCh38)
Location 16:52443943-52443965
Sequence TGTCCTCTGTTTAAACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137917103 Original CRISPR TGTCCTCTGTTTAAACTGGG AGG (reversed) Intronic
902179328 1:14675959-14675981 TGTCCTGTGCTTAGACTTGGAGG - Intronic
905900594 1:41579908-41579930 GGTCCTCTGTTTACGCTGGTTGG - Exonic
917342902 1:173998267-173998289 TGTCTTCTGTTTCAATTGGAAGG - Intronic
922552950 1:226510488-226510510 TCTCCTCCCCTTAAACTGGGTGG + Intergenic
1064181063 10:13116116-13116138 TGTGCACTGTTTAAACGGGGTGG - Intronic
1064821560 10:19340613-19340635 TGTACTCTGCATAGACTGGGAGG + Intronic
1065184362 10:23157695-23157717 TGTCCTCTGGTCAACCGGGGAGG + Intergenic
1069303694 10:66941083-66941105 AGTCCTCTGTTTATCCAGGGAGG + Intronic
1070363962 10:75717701-75717723 TGTGCTCTGTTTTAAAGGGGAGG - Intronic
1074912094 10:117920867-117920889 TGACATCTGTTGAAACTGGGAGG + Intergenic
1075204777 10:120437389-120437411 TGACATCTGGTGAAACTGGGAGG - Intergenic
1075509780 10:123062365-123062387 GGTCCTTTGTTTAAATTGGATGG + Intergenic
1075834076 10:125438211-125438233 TGTCCCTGTTTTAAACTGGGTGG + Intergenic
1077698273 11:4414987-4415009 TGTCTTCTGAGTAAACTGTGGGG - Intergenic
1081288403 11:41301720-41301742 TCTCCTCTGATGAAATTGGGGGG - Intronic
1085383781 11:76143749-76143771 TGGCCTCTGTTTAAAGTGGCTGG + Intergenic
1088211920 11:107466236-107466258 TGTGCTTTGTTTAAACTGCGAGG + Intergenic
1088604595 11:111515686-111515708 TGTCCTCTGGATAAACAGGGTGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095462748 12:42459863-42459885 TGTCCTCTGACCAAACTGAGGGG + Exonic
1099492588 12:83305639-83305661 TGTTCTCTGTTGTAAGTGGGAGG + Intergenic
1105662731 13:22516601-22516623 TATCCTCTGTTTAATCAGTGAGG + Intergenic
1107730811 13:43346423-43346445 TCTCCTCTGGTTAAAGTGTGAGG - Intronic
1108332369 13:49401729-49401751 TGTCAACTGATTAAACTGGCTGG + Intronic
1108531350 13:51330120-51330142 TGAACCCTGTTTAAACTAGGTGG + Intergenic
1109170147 13:59085090-59085112 TGTCCTGTGTTTTAAATGGGTGG + Intergenic
1111594364 13:90391880-90391902 GGTCTTCTGTTTATACTGGTTGG - Intergenic
1115971443 14:38949163-38949185 TGGCCTGTGTTTAAACTGCGTGG - Intergenic
1118346387 14:64944235-64944257 TGTCCCCTGCTGAAGCTGGGTGG + Intronic
1124805899 15:32882500-32882522 TGTCCACTGTCTACACTGGTAGG + Intronic
1130047512 15:80457203-80457225 TGTCTTATGTTTACACTGAGAGG + Intronic
1130607107 15:85327768-85327790 TGTGTTCTGTTTAAAATGGTAGG - Intergenic
1132296463 15:100738416-100738438 TGTCCTCTGATAAAACTAGCTGG - Intergenic
1137917103 16:52443943-52443965 TGTCCTCTGTTTAAACTGGGAGG - Intronic
1139258364 16:65565457-65565479 TAACATCTGTTTAATCTGGGAGG - Intergenic
1142845470 17:2671901-2671923 GGTTCTCTGTTTAAAATGGTGGG - Intronic
1144043988 17:11438524-11438546 TTTCCTCTGTTTGTGCTGGGAGG + Intronic
1145977383 17:28992241-28992263 TTTCCTCTGTGTGAACTAGGAGG - Intronic
1146402531 17:32511122-32511144 TGTCCTCTGATTGATGTGGGAGG - Intronic
1149137822 17:53391015-53391037 AGTCCTCAATTTAAACTGGAAGG - Intergenic
1149941952 17:60879688-60879710 TGGCCTCTGTTTTTACTTGGAGG + Intronic
1151994620 17:77600827-77600849 TGTACTCTTTATACACTGGGAGG - Intergenic
1153679384 18:7485721-7485743 TATCCTCTGTTCAAAGTGGGTGG - Intergenic
1158718662 18:59903105-59903127 TGACCTGTGATTAGACTGGGCGG + Exonic
1160149582 18:76388878-76388900 GGTCCTCTCTTCACACTGGGCGG + Intronic
1160173479 18:76573312-76573334 TGACATCTGGTAAAACTGGGAGG - Intergenic
1160335781 18:78037857-78037879 TTTCTGCTGTTTAAACTGGCTGG + Intergenic
1160398505 18:78590233-78590255 TGGCCTCTGTTAAAACTGTTGGG - Intergenic
1162276790 19:9662161-9662183 TGTCTTCTGGTCATACTGGGGGG - Intronic
1164226583 19:23251380-23251402 TGTTCACTGTTTAATCTGGAAGG - Intergenic
1167191837 19:47995825-47995847 TCTCCCATGTTTCAACTGGGTGG - Intronic
928749496 2:34455331-34455353 TGTCCTCTGTTTAAAATTATGGG - Intergenic
931832474 2:66067045-66067067 TTTCCTCTGTCTACACTGGCTGG - Intergenic
932407863 2:71525887-71525909 TGTACTATGTTTTAACCGGGAGG + Intronic
933332982 2:80918662-80918684 TGTCATCTGTTTAAAGTAGTGGG - Intergenic
933800300 2:85955033-85955055 TCTCTTCTGTTTAAATTGGAGGG + Intergenic
937301410 2:120844937-120844959 TGCCCCCTGTGTAGACTGGGTGG + Intronic
941195621 2:162448006-162448028 TGTTCTCTCTATAAACTGGCTGG - Intronic
945176978 2:207052933-207052955 GGTCATTTGTTTAAAATGGGAGG + Intergenic
945255138 2:207797041-207797063 TGGCCTCTGTGTAAAGTGGAGGG + Intergenic
946802130 2:223429673-223429695 TTTCCTCTGTTTGAAATGAGTGG - Intergenic
946971781 2:225101440-225101462 TTTTTTCTTTTTAAACTGGGAGG + Intergenic
1169271921 20:4206925-4206947 TGTCTTCTGTTTTTGCTGGGTGG + Intergenic
1171190209 20:23153632-23153654 TGTCCTCTGTCAGACCTGGGTGG - Intergenic
1172964873 20:38827283-38827305 TGACCTCTGTCTGAACTGGCTGG - Intronic
1173470479 20:43319850-43319872 TGACATCTGGTGAAACTGGGAGG - Intergenic
1174768136 20:53272968-53272990 TCTCCTCTATTTAAAGTAGGTGG - Intronic
1177950130 21:27525239-27525261 TGTCTTTTATTTAAACTGGATGG + Intergenic
1179937681 21:44615508-44615530 TGACATCTGGTTAAGCTGGGTGG - Intronic
1180579539 22:16818708-16818730 TGTCCTCTGTTTTAGCTGGTTGG - Intronic
1183054889 22:35299328-35299350 TGTCATCTGTTGAGACTGAGAGG - Intronic
1185152682 22:49174544-49174566 TGTTCTGTGTTTTAATTGGGTGG - Intergenic
949995203 3:9611175-9611197 TGTCCTTTCTTTACACTGGGAGG - Intergenic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
951786271 3:26422610-26422632 TGTCCACTGTTGAATCTTGGAGG + Intergenic
952758222 3:36890954-36890976 TTTCCTCACTTGAAACTGGGAGG + Intronic
955783894 3:62515698-62515720 TTTCCTCTGTTTAAAGAAGGGGG + Intronic
956865830 3:73367631-73367653 TGTGCTCTGGTATAACTGGGAGG - Intergenic
958871273 3:99561908-99561930 GGCCCTCTCCTTAAACTGGGCGG + Intergenic
959580343 3:107976871-107976893 GGCCCTCTGCTCAAACTGGGTGG + Intergenic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963055291 3:141181665-141181687 TGTTGTCTGTTTAAAATGGGTGG + Intergenic
963753502 3:149208239-149208261 TGGTCACTGTTCAAACTGGGTGG + Intronic
964362396 3:155912353-155912375 TTTTCTCTGTTTAAGCTAGGGGG + Intronic
964887482 3:161501603-161501625 TGCACTCTGTTTAAACTTGTAGG + Intronic
966215709 3:177500117-177500139 TGTCCTCCTTTCAAACTGGATGG - Intergenic
967677756 3:192319772-192319794 TGTCATCAGTTTAAAATGGTGGG + Intronic
968666726 4:1826473-1826495 TGGCCTCTGTCTTGACTGGGTGG - Intronic
969388776 4:6875118-6875140 TGTCCTCTGCTGAGGCTGGGAGG - Intronic
972294040 4:37719487-37719509 TTTTCTCTCTTAAAACTGGGAGG + Intergenic
973016124 4:45140090-45140112 TGTCTTCTGTTTCAATTGGGAGG + Intergenic
975290333 4:72670760-72670782 TATTCACTGTTAAAACTGGGCGG + Intergenic
979181095 4:117728546-117728568 TGTCCTCTGTTTAAAATGTCTGG - Intergenic
983909935 4:173226648-173226670 TGTCTTCTGTGTGAACTTGGAGG + Intronic
984487284 4:180387011-180387033 TGTACACTTTTTAAAGTGGGAGG + Intergenic
987093981 5:14532303-14532325 TGGCCTTTGTTGAGACTGGGAGG - Intergenic
987835244 5:23152046-23152068 TGTACTATGTTTAAATTGGCAGG + Intergenic
989381578 5:40814097-40814119 TGACATCTGGTAAAACTGGGAGG - Intergenic
989799269 5:45516246-45516268 TGTTCAATGTTTAAACAGGGAGG - Intronic
992412863 5:76524111-76524133 TGTCCTTTGCCTTAACTGGGGGG - Intronic
995049862 5:107690202-107690224 TGTCCTCAGTTTAAAATAGTGGG + Intergenic
995280014 5:110323579-110323601 TATCCTCTGTTTACACTGTGGGG - Intronic
995971682 5:117979494-117979516 TGTCATCAGTTTAAAATAGGTGG - Intergenic
997426630 5:133807431-133807453 TGTCCTCCGTTTAAAGTATGAGG - Intergenic
998782968 5:145678748-145678770 TGTCCTATCTGCAAACTGGGGGG + Intronic
999295514 5:150457391-150457413 TGTCCTCAGTTATAACGGGGGGG - Intergenic
1001766841 5:174255766-174255788 TGTTCAGTGTTTAAACTGGGAGG + Intergenic
1009923666 6:70094457-70094479 AGTACTCTCTTTAAACTGGCAGG - Intronic
1012265095 6:97132021-97132043 TGTCTTCTTTTTGAAATGGGAGG + Intronic
1013067173 6:106695014-106695036 TGTCAGTTTTTTAAACTGGGAGG - Intergenic
1013067665 6:106699328-106699350 TTTCCTCCTTTTAAAATGGGAGG - Intergenic
1013512226 6:110855633-110855655 TGTAATCTGTATAAACTGGTCGG - Intronic
1015225199 6:130849759-130849781 TCTCCCTTGTTTAAACTGTGAGG - Intronic
1018060662 6:160087238-160087260 TGTGCTCTGTTATTACTGGGAGG + Intronic
1020591889 7:10149265-10149287 TGTTTTCTGTTTATACTTGGAGG + Intergenic
1022150679 7:27601231-27601253 GGTCCTCTGTTTAAAGTTGTTGG + Intronic
1023204797 7:37736476-37736498 TTTCCTCTGTTTATACTGTTTGG - Intronic
1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG + Intronic
1028873864 7:95799081-95799103 TTTCCTCTATTGAAACTGAGGGG + Intronic
1033040744 7:137915803-137915825 TTTCGTCTGTTTAAACAGGTTGG - Intronic
1033524733 7:142199443-142199465 TGTCCTCCAGTTAAACTGGATGG - Intronic
1034246009 7:149644983-149645005 TTTGCTTTGTTTAAACTGGTAGG + Intergenic
1034699066 7:153080978-153081000 GGTCATCTGGTGAAACTGGGAGG - Intergenic
1036604043 8:10290720-10290742 AGACCTCTTTTTAAACTTGGTGG + Intronic
1036912647 8:12770379-12770401 TGACATCTGTTGAAACTGGGAGG + Intergenic
1038494262 8:27990505-27990527 TGGCTTATGTTTAAAATGGGAGG - Intronic
1041148747 8:54909167-54909189 TATCCAGTGTTTAAACTGGAAGG + Intergenic
1043241455 8:77940293-77940315 TGTCCAGTGTTTAAACTCTGAGG - Intergenic
1044077455 8:87840238-87840260 TATCCTCTGAGTACACTGGGAGG - Intergenic
1045337113 8:101215724-101215746 TGTTGTCTGTGTAAACTGGGGGG + Intergenic
1046056704 8:109086898-109086920 TGTCCTCTCTTGAATCTGTGGGG + Intronic
1049751528 8:144286552-144286574 TGTCCTGTGCTTTAGCTGGGAGG - Intronic
1052166374 9:25335124-25335146 ATTTCTCTGTTTAAAATGGGGGG - Intergenic
1052834635 9:33241314-33241336 TTTCCTCTGACTAAAATGGGAGG + Intronic
1054753552 9:68933489-68933511 TGTTTTCTGGTTAAACTGAGGGG - Intronic
1059962503 9:119579062-119579084 TGTTCTCTGTTCATACTGGAAGG + Intergenic
1061632057 9:131878569-131878591 TGTCCCCTGCCTAACCTGGGTGG + Intronic
1185770322 X:2760984-2761006 TGTCCACTGTTTAAACAGCCTGG + Intronic
1188502929 X:30848627-30848649 TGGCTTCTGATTAAACTGAGGGG + Intronic
1188647459 X:32588401-32588423 AGTCGTCTGTTTAAACCCGGTGG + Intronic
1190507031 X:51136445-51136467 TGTACCCTGTATAAAGTGGGTGG + Intergenic
1190587943 X:51965670-51965692 TGTCATCTGTTTAAAATAGTGGG - Intergenic
1193903633 X:87216217-87216239 TGCCCTCTGCTTACACAGGGAGG - Intergenic
1199144690 X:144350949-144350971 TGTGCTGGGTTTAATCTGGGTGG - Intergenic