ID: 1137923487

View in Genome Browser
Species Human (GRCh38)
Location 16:52516090-52516112
Sequence GTTCATCTGGTCCAAAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137923483_1137923487 22 Left 1137923483 16:52516045-52516067 CCTCAAAGAATCAATCACATATT 0: 1
1: 0
2: 2
3: 38
4: 288
Right 1137923487 16:52516090-52516112 GTTCATCTGGTCCAAAGTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137923487 Original CRISPR GTTCATCTGGTCCAAAGTGT TGG Intronic
903816805 1:26069849-26069871 GGTCATCTGGTCCAAGGCGATGG + Intergenic
905987391 1:42299133-42299155 GTCCATCTGGTCTACAGTTTAGG + Intronic
906576777 1:46898358-46898380 CTCCATCTGGTCCCTAGTGTCGG - Intergenic
906595141 1:47069227-47069249 CTCCATCTGGTCCCTAGTGTGGG + Intronic
912277763 1:108278409-108278431 GTTCATTTGGTTGAAAATGTTGG + Intergenic
912290463 1:108415950-108415972 GTTCATTTGGTTGAAAATGTTGG - Intronic
917222009 1:172742084-172742106 GTTCCTCTGGCCCAAAATTTGGG + Intergenic
918843494 1:189576968-189576990 GTTCATGTGGTCCCAAGAGAAGG - Intergenic
920756186 1:208736150-208736172 CTTCTGCTGGTCCAAAATGTAGG - Intergenic
921479188 1:215644407-215644429 GTTCATCTGCTCCAAGGCTTTGG - Intronic
921684454 1:218074196-218074218 GTTCATCTGCTCCCAAATCTGGG + Intergenic
921829819 1:219714797-219714819 GTTGATCTGATCCAATGTGAAGG - Intronic
924068108 1:240246986-240247008 GTTCTTCTTCTCCAAGGTGTTGG + Intronic
1062921912 10:1286583-1286605 GTTCTTCTGATCCCAAGTTTAGG - Intronic
1063048995 10:2425020-2425042 GTTCATCTGGGGCCAAGTGTAGG + Intergenic
1063814415 10:9756426-9756448 GATTATATGGTCCAAAGGGTAGG + Intergenic
1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG + Intronic
1071550443 10:86562395-86562417 CTTCATCTGGGTGAAAGTGTTGG + Intergenic
1071754479 10:88521373-88521395 GTTCATGTGGTCTGAAATGTTGG + Intronic
1072258174 10:93641008-93641030 CTTCATCTGGTACAAATTATTGG - Exonic
1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG + Intergenic
1076421819 10:130337266-130337288 GTTCATCTGCTCCATAGCCTTGG + Intergenic
1076547824 10:131257625-131257647 AATCATCTGGCCCAAAGTATAGG - Intronic
1077462531 11:2717824-2717846 GTTCCTCTGGCCCAAGGTCTTGG - Intronic
1078270266 11:9788436-9788458 CTTCCTCTGGTCAGAAGTGTGGG - Intronic
1086238160 11:84657446-84657468 GGACTTCTGGTCCAATGTGTAGG - Intronic
1087202238 11:95357448-95357470 GTTCAGCTGGACCAAAATTTTGG + Intergenic
1087492135 11:98841926-98841948 GTCCATTTGGTCTATAGTGTAGG + Intergenic
1087856563 11:103098854-103098876 ATGCATCTGGTCCTAAGTATAGG - Intergenic
1088008874 11:104974624-104974646 ATTCATTTGGTCCAAAAAGTTGG + Intergenic
1089743499 11:120601091-120601113 GTTCTTCTTGTCCAAAATGTGGG - Intronic
1095602069 12:44024931-44024953 CTTCATCTATTCCTAAGTGTAGG + Intronic
1100592645 12:96043882-96043904 GTTTATCAGGTCAAAAGTCTTGG - Intergenic
1101840362 12:108323671-108323693 TGCCATCTGGTCCAATGTGTAGG + Intronic
1103560267 12:121789896-121789918 GCTCATCAGGGCCAAGGTGTGGG - Intronic
1104121568 12:125805016-125805038 GGTGATCTGTTCCAAAGTGCTGG + Intergenic
1110209497 13:72954717-72954739 TTCCATCTGGTTCACAGTGTAGG + Intronic
1116311314 14:43330002-43330024 TTTCATCTGGTCCAAAATATAGG - Intergenic
1119906097 14:78303525-78303547 GCTCATCTGTTCCAAAGTTTTGG + Intronic
1125360069 15:38855868-38855890 GTTTATCTAGTCCACAGTGGAGG + Intergenic
1126954346 15:53915300-53915322 TTTAATCTATTCCAAAGTGTTGG - Intergenic
1127196699 15:56593875-56593897 GTCCATTTGGTCTAAAGTGCAGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1130659650 15:85820711-85820733 GCTCATCTGGATCAAAATGTTGG - Intergenic
1135246057 16:20858108-20858130 TTTAATCTGTTCCAAAGTGTTGG + Exonic
1137923487 16:52516090-52516112 GTTCATCTGGTCCAAAGTGTTGG + Intronic
1138211438 16:55166538-55166560 GTTCTTCTGCACCAAAGGGTTGG + Intergenic
1143004087 17:3815980-3816002 GTTCATCATGTCTAAATTGTGGG - Intronic
1147837714 17:43346772-43346794 TTTAATCTGTTCCAAAGTGTTGG - Intergenic
1151151426 17:72091176-72091198 TTTCATCTTGTACAAAGTCTTGG - Intergenic
1155950431 18:31905379-31905401 GTCCATATGCACCAAAGTGTAGG - Intronic
1159028869 18:63210862-63210884 GTGAATGGGGTCCAAAGTGTGGG - Intronic
1159744477 18:72213985-72214007 TTTTAGCTGGTCCAAAGAGTTGG + Intergenic
1163827581 19:19532337-19532359 GTTCTACTGCTCCAAAGCGTGGG - Intronic
929057771 2:37893299-37893321 GTTCCTCTGGTCTAGTGTGTGGG - Intergenic
931231086 2:60375425-60375447 GTGCAGCTGGTCCTGAGTGTTGG - Intergenic
933547088 2:83728442-83728464 ATTCATTTGGCCTAAAGTGTGGG + Intergenic
940324701 2:152412880-152412902 GTTCATATGGTCCAAACTAATGG - Intronic
942565218 2:177259366-177259388 GTTTATTTGGTCCAAACTGCTGG - Intronic
947066091 2:226227177-226227199 GGTCATCTGGTCCAACTAGTAGG - Intergenic
1180165530 21:46023928-46023950 AAGCATCTGGTTCAAAGTGTTGG + Intergenic
1182237269 22:28884794-28884816 TTTCATTTGGTCCAAGGTGGAGG - Intronic
1182836974 22:33350171-33350193 GTTCATCATGTTCAATGTGTTGG + Intronic
949378850 3:3421956-3421978 GTTGATCTAGTCCAATTTGTGGG - Intergenic
952441083 3:33329993-33330015 GTTGATCTGGTCCAGTGTGGTGG + Intronic
953304692 3:41817129-41817151 GTTCATTTGGACCACTGTGTAGG - Intronic
959244491 3:103847269-103847291 CTCCATCTGGTGCGAAGTGTAGG - Intergenic
961855635 3:129868280-129868302 GTTCATTTTTTCCAAACTGTTGG - Intronic
962627846 3:137244747-137244769 TTTAATATGTTCCAAAGTGTAGG + Intergenic
968447041 4:657388-657410 GTTCATCTTGTCGTAGGTGTCGG - Exonic
968679144 4:1904290-1904312 TTTGGTGTGGTCCAAAGTGTCGG + Exonic
971162349 4:24146498-24146520 GTGCCCCTGGTCCCAAGTGTAGG - Intergenic
976474797 4:85471836-85471858 AATCATGTGATCCAAAGTGTTGG + Intergenic
977446011 4:97133450-97133472 GTTCTTTTGGAGCAAAGTGTAGG - Intergenic
978500151 4:109400718-109400740 GTTCACCTTGTTGAAAGTGTTGG - Intergenic
983679099 4:170331309-170331331 GTTCCACTGGGCCAAAGTCTAGG + Intergenic
984425866 4:179584786-179584808 ATTCATCTGGATCAAATTGTTGG + Intergenic
984531289 4:180919749-180919771 GAGCATCTGGTAAAAAGTGTAGG - Intergenic
986495227 5:8334480-8334502 GTTCATGCAGTCCAAAGTGAAGG + Intergenic
992846108 5:80749825-80749847 GGTCAACTGGTGCAAAGTTTTGG - Intronic
995063719 5:107838321-107838343 ATTCAGGTGGTCCAAAGGGTGGG - Intergenic
997558752 5:134825082-134825104 TTTAAACTGGTCCAAATTGTCGG + Intronic
999527865 5:152427629-152427651 GGTCATCTGGATTAAAGTGTGGG + Intronic
1001678475 5:173537970-173537992 GATCAACTGGTTCAAAATGTGGG + Intergenic
1002390365 5:178906910-178906932 TTTAATCTGTTCCAAAGTGTTGG + Intronic
1006381246 6:33698634-33698656 AATTATCTGGCCCAAAGTGTTGG - Intronic
1008628139 6:53337664-53337686 GTTTATCTGGCACATAGTGTAGG - Intronic
1009396788 6:63207994-63208016 CTATATCTGGTTCAAAGTGTTGG - Intergenic
1011842177 6:91515355-91515377 TTTCATTTGGTCAAAATTGTTGG - Intergenic
1015924800 6:138297860-138297882 GGTCAGCTGGTGCAAAGTCTGGG + Intronic
1020450609 7:8316574-8316596 TTCCATCTGGTTCACAGTGTAGG + Intergenic
1021991208 7:26143099-26143121 GTCCATCAGATCCAAAGTGCTGG - Intergenic
1022459143 7:30587464-30587486 GATCATCTGGTCCACAGGCTGGG + Intergenic
1026542519 7:71292824-71292846 GGTCAAATGGTCCAAAGTTTTGG - Intronic
1027500846 7:78949372-78949394 CTTCATCTGGTAAAAAGTCTTGG + Intronic
1030386413 7:108872659-108872681 GTTCACCTGTTCCAAAGATTAGG + Intergenic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1041633787 8:60119312-60119334 GTTCATGTTGTCCAAATGGTAGG + Intergenic
1047109165 8:121769375-121769397 GTTCATGTTGACCAAAATGTTGG - Intergenic
1047314588 8:123720997-123721019 GTTCAACTGGTACAAAGTTTTGG - Intronic
1048309678 8:133311105-133311127 TTTCCTCTGGTCCTAACTGTTGG + Intergenic
1050917247 9:11152565-11152587 GTTCATCTAGCTAAAAGTGTGGG - Intergenic
1051398487 9:16653679-16653701 GTTCATCTGGTCGGCAGGGTGGG + Intronic
1052919049 9:33948501-33948523 TTTCAACTGGTCCAAAATCTGGG + Exonic
1056400901 9:86226247-86226269 GTATATTTGGTCCAAAGAGTTGG - Intronic
1059104215 9:111497734-111497756 GTTCATCTGGGCCAAGGTTTAGG - Intergenic
1060285845 9:122251601-122251623 GTGCATTTGGTCAAAAATGTAGG + Intronic
1060885448 9:127149060-127149082 GTTCCTCTGGTCCTCAGTTTTGG - Intronic
1060892832 9:127199341-127199363 GTAGATTTGGTCCGAAGTGTGGG + Intronic
1061802536 9:133120378-133120400 GGACATCTGGTCCCACGTGTTGG + Intronic
1187322068 X:18248550-18248572 CTTCATCTGGTTCAAAATTTTGG + Intronic
1187359372 X:18610366-18610388 GTCCATCTGGAACAAACTGTGGG - Intronic
1189663736 X:43331089-43331111 GTACAGGTGGTCTAAAGTGTGGG - Intergenic
1191972302 X:66830107-66830129 GTTCATTTGGTCTACAGTGCAGG - Intergenic
1196748236 X:119090854-119090876 TTCCATCTGGTTCACAGTGTAGG - Intronic
1199565783 X:149214359-149214381 CTGCCTCTGGTCCCAAGTGTCGG - Intergenic
1199768795 X:150960279-150960301 GTTCATCTAGTCCAAGGTATGGG - Intergenic
1200911582 Y:8536028-8536050 GTTTATTTGGTACGAAGTGTCGG - Intergenic