ID: 1137924349

View in Genome Browser
Species Human (GRCh38)
Location 16:52525772-52525794
Sequence GCAGTGATAATGCACTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137924340_1137924349 30 Left 1137924340 16:52525719-52525741 CCAACATTTTCCCATATTTTGTC 0: 1
1: 0
2: 3
3: 46
4: 443
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157
1137924343_1137924349 8 Left 1137924343 16:52525741-52525763 CCACTCCCTCTCTTCCTTGTTAT 0: 1
1: 1
2: 6
3: 106
4: 1147
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157
1137924346_1137924349 3 Left 1137924346 16:52525746-52525768 CCCTCTCTTCCTTGTTATGGGTA 0: 1
1: 0
2: 0
3: 15
4: 237
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157
1137924348_1137924349 -6 Left 1137924348 16:52525755-52525777 CCTTGTTATGGGTAGCAGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157
1137924347_1137924349 2 Left 1137924347 16:52525747-52525769 CCTCTCTTCCTTGTTATGGGTAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157
1137924342_1137924349 19 Left 1137924342 16:52525730-52525752 CCATATTTTGTCCACTCCCTCTC 0: 1
1: 0
2: 0
3: 20
4: 351
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157
1137924341_1137924349 20 Left 1137924341 16:52525729-52525751 CCCATATTTTGTCCACTCCCTCT 0: 1
1: 0
2: 2
3: 16
4: 261
Right 1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG 0: 1
1: 0
2: 1
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137924349 Original CRISPR GCAGTGATAATGCACTTTAA TGG Intronic
903283248 1:22262238-22262260 AAAGAGATAATGCACTTGAAGGG + Intergenic
905392072 1:37642725-37642747 GCAGAGATAAGGCACTATGAAGG - Intergenic
906185064 1:43856273-43856295 AATGTGATAATGCACTTTTATGG + Intronic
906277790 1:44530497-44530519 ATTGTGATAATGCACTTTCATGG + Intronic
906870056 1:49468783-49468805 ATTGTGATAATGCACTTTCATGG - Intronic
906905349 1:49883857-49883879 GCAGTGTTAATTCAATATAATGG + Intronic
908065193 1:60395862-60395884 GCAGTGATATTGCACAGTACTGG + Intergenic
908950088 1:69550247-69550269 GCACTCAAAGTGCACTTTAATGG + Intergenic
909546173 1:76850516-76850538 GTAGTGATAATGCATTGTCATGG - Intergenic
911865903 1:103021677-103021699 GTAGTGTGAATACACTTTAAAGG - Intronic
912801347 1:112721664-112721686 CCAGTGATAATCCACTGTTAAGG - Intronic
914325930 1:146616252-146616274 GTCGTGATAATGCACTTGCATGG - Intergenic
919479499 1:198070113-198070135 GCGGTGATAATGCAATTTACTGG + Intergenic
921071161 1:211659052-211659074 GCTGTGACAATGTACTTTCATGG + Intronic
921478826 1:215640341-215640363 GCAGTTATAATGCAGTTCAAGGG - Intronic
923247126 1:232143423-232143445 GCAGTGACTAGGCATTTTAAAGG + Intergenic
924329370 1:242926618-242926640 GCAGAGATAATTCATTTTCATGG - Intergenic
1063827502 10:9914342-9914364 ATTGTGATAATGCACTTTTATGG - Intergenic
1067129575 10:43550231-43550253 GCAGAGATAAAACAGTTTAATGG - Intergenic
1068428631 10:56902604-56902626 GGATTGAGAAGGCACTTTAAGGG + Intergenic
1069038571 10:63670848-63670870 GCATTGGTAATGTACTTTAATGG + Intergenic
1069341526 10:67415492-67415514 TCAGTGATAATGCAAATAAATGG + Intronic
1072220751 10:93325787-93325809 GCAGGGATAATGGTCTTCAAGGG + Intronic
1075355394 10:121768267-121768289 ACAGTGTGAATGCACTTAAAAGG + Intronic
1078518815 11:12047360-12047382 GCAGGGAAAAGGCACTTTACTGG - Intergenic
1079554637 11:21743823-21743845 GCAGTTATAAATCACTTCAAGGG + Intergenic
1080796827 11:35572039-35572061 TCAGTGATAAAACACTTGAAGGG - Intergenic
1081244041 11:40742052-40742074 GAAGTGATAATGCCCCTTTATGG - Intronic
1082226632 11:49715206-49715228 GCAGTGGTGATGCACATAAATGG - Intergenic
1084231743 11:67758482-67758504 GCAGCAATACTGCTCTTTAATGG + Intergenic
1085994512 11:81894138-81894160 GAAGTGATAATGAACTTGTAAGG - Intergenic
1086622795 11:88907872-88907894 GCAGTGGTGATGCACATAAATGG + Intronic
1087520821 11:99233161-99233183 GCTGTGACAAAGCACTATAAAGG - Intronic
1089383720 11:118054231-118054253 ATGGTGATAATGCACTTTCAGGG - Intergenic
1090468813 11:126959860-126959882 GCAGTGCTAATGGCCGTTAAGGG - Intronic
1090952560 11:131486457-131486479 GCAGTGAGGATGCTCTTCAATGG + Intronic
1092021653 12:5207744-5207766 ACAGTCCTAATGCACCTTAAGGG + Intergenic
1092910600 12:13141661-13141683 GCAGTAATAATGCAGTGGAAGGG - Intronic
1094078336 12:26503539-26503561 GCAATGACAATGCACGTTAGTGG + Intronic
1104229876 12:126874443-126874465 GCAGTGATAATGACCTTCATGGG + Intergenic
1109142509 13:58732803-58732825 ATTGTGATAATGCACTTTTATGG + Intergenic
1112609577 13:100943236-100943258 GCAGAGATAATCCGCTGTAAAGG - Intergenic
1114589833 14:23852295-23852317 GTTGTGTTAATGCACTTTCATGG - Intergenic
1115481410 14:33865105-33865127 GTTGTGATAATGCACTTTTGTGG + Intergenic
1116656313 14:47657747-47657769 GCAATGATAATGGAATTTACTGG + Intronic
1120664232 14:87286954-87286976 GCAGTGACAGTGCCCTTTCAAGG + Intergenic
1120753021 14:88215883-88215905 AGAGTGAAGATGCACTTTAAAGG + Intronic
1121217314 14:92258699-92258721 GCAGTAATAAGGCACTGTCATGG + Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1126078538 15:44936467-44936489 GCATTGTGAATGCACTTTAGTGG - Intergenic
1126079310 15:44943858-44943880 GCATTGTGAATGCACTTTAGTGG + Intergenic
1126685400 15:51244385-51244407 GCACTGAAAATGCACTGGAAAGG + Intronic
1126716083 15:51519098-51519120 GCAGTTTTGATGCACATTAATGG - Intronic
1126834982 15:52653073-52653095 CCACTGATAATGCATTTTATAGG - Intronic
1127536754 15:59897116-59897138 GCAGTGCTGCTGCACTTTGAAGG - Intergenic
1129173869 15:73825480-73825502 ATTGTGATAATGCACTTTTATGG - Intergenic
1130582421 15:85150551-85150573 GCAGTGAAAATACTCTATAATGG + Intergenic
1130952106 15:88600351-88600373 GCTGTGATAATTAAATTTAAGGG + Intergenic
1131205258 15:90439911-90439933 GCAGTGGTAATACTGTTTAAGGG + Intronic
1133627532 16:7585324-7585346 GCACTGAAAATGCTCTGTAAAGG + Intronic
1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG + Intronic
1140007635 16:71094690-71094712 GTCGTGATAATGCACTTGCATGG + Intronic
1140303507 16:73780846-73780868 GCAGTTATGTTGCACTTTCATGG - Intergenic
1145970575 17:28954101-28954123 GCAGTGGTAATGCAGCTTACGGG - Intronic
1152174194 17:78776291-78776313 CCACATATAATGCACTTTAAGGG - Intronic
1153848195 18:9068762-9068784 GCAGTGACATTGCACTGTATTGG - Intergenic
1159344468 18:67181951-67181973 GCAGAGATACTGCAATTTAAAGG + Intergenic
1164736797 19:30547271-30547293 GCAATCATAATGCACTGTAATGG + Intronic
1165714240 19:38034262-38034284 GCAGTAATAATGAACATTAATGG + Intronic
925299401 2:2799976-2799998 GCAGAGATAAAGCACTGTATTGG - Intergenic
929735132 2:44539802-44539824 GAAATGATGATGCACTTTATTGG + Intronic
931631298 2:64303321-64303343 GATGTGATAATGCACTTTCATGG + Intergenic
935658550 2:105445571-105445593 GTTGTGATAATGCACTTTCATGG + Intergenic
935725511 2:106020619-106020641 GCAGTGCTAATGCAATTAAAGGG + Intergenic
936898164 2:117453011-117453033 GAAATGATAACACACTTTAATGG - Intergenic
937538016 2:122914764-122914786 GCAATGAAAATACACCTTAATGG - Intergenic
938917730 2:135959808-135959830 GAGGTTATAATGCAGTTTAATGG + Intronic
940495299 2:154420054-154420076 ACTGTGATATTTCACTTTAAGGG - Intronic
941752426 2:169147206-169147228 GCTTTCATAATGCATTTTAAAGG - Intronic
944261170 2:197678974-197678996 GCAGAGAAAATGCATTCTAATGG + Intergenic
944940201 2:204616941-204616963 ACAGAGATAATGAAGTTTAAGGG - Intronic
945670439 2:212795910-212795932 CCAGTGACAATATACTTTAAGGG + Intergenic
947075545 2:226340489-226340511 ATTGTGATAATGTACTTTAATGG - Intergenic
948642282 2:239383297-239383319 TCAGTGGTTATGCACTTTACGGG - Intronic
1168953744 20:1819897-1819919 GCAGTGAAAATGCACATGTAAGG - Intergenic
1173693573 20:44986208-44986230 GCAGTGACAAGGTAATTTAAGGG + Intronic
1174669061 20:52288918-52288940 GCAATGATGATGCATTCTAAGGG - Intergenic
1182973685 22:34602140-34602162 GCAGTTTTGATGCACTTTCAGGG + Intergenic
1184308879 22:43628333-43628355 CCAGTGCTAATGCACTCTGAAGG - Intronic
1184462044 22:44644169-44644191 GCTGTGATAATGCACTTTTGTGG - Intergenic
949189441 3:1233952-1233974 GCAGTAAGAATGCATTTTAAAGG + Intronic
950166190 3:10801561-10801583 GTTGTGACAATGCACTTTCATGG + Intergenic
951294154 3:20913261-20913283 ATTGTGATAATGCACTTTCATGG - Intergenic
951460926 3:22951075-22951097 GCAGTGAGAAGGCACCTCAAGGG - Intergenic
952062375 3:29526048-29526070 CCAGTGAGAAGGCACCTTAAGGG + Intronic
952903445 3:38124769-38124791 AATGTGATAATGCACTTTCATGG + Intronic
955377692 3:58411786-58411808 GTAGTGCTAATGAACTTTAATGG - Intronic
955441431 3:58959532-58959554 GAAGTGCTAAAGCAATTTAATGG - Intronic
956044536 3:65181350-65181372 GCAGTGACAATACATTTAAATGG + Intergenic
957048372 3:75393792-75393814 GCAGCAATACTGCTCTTTAATGG + Intergenic
958734947 3:97997913-97997935 AATGTGATAATGCACTTTCATGG + Intronic
959730466 3:109595599-109595621 GCAGTGAGACTGCTCTTTAGGGG + Intergenic
960222952 3:115137380-115137402 GCAATAAAAATTCACTTTAAAGG + Intronic
961857777 3:129890192-129890214 GCAGTGCTCAAACACTTTAAGGG + Intronic
961880446 3:130057889-130057911 GCAGCAATACTGCTCTTTAATGG + Intergenic
962130707 3:132671817-132671839 TCAGTGAAAATGCAGTTTCAGGG + Exonic
965043036 3:163535134-163535156 TCAGTGATATTGCAATTTGAAGG - Intergenic
965924668 3:173963101-173963123 GATGAGATAATGCATTTTAAAGG - Intronic
967031503 3:185611580-185611602 ACAGAGATAATGCATATTAATGG + Intronic
968992838 4:3926242-3926264 GCAGCAATACTGCTCTTTAATGG + Intergenic
972028069 4:34412380-34412402 GAAGTGATCATTTACTTTAAAGG - Intergenic
972416001 4:38841235-38841257 GTTGTGATAATGTACTTTTATGG - Intronic
973956518 4:56068522-56068544 GCATTGAAAATGGACTTTAGGGG + Intergenic
975669304 4:76764597-76764619 CCAGTGAAAATGCCCTTCAAGGG - Intronic
976254535 4:83086200-83086222 TTCGTGATAATGCACTTTCATGG + Intergenic
977445061 4:97121067-97121089 TCAGTGCTAAGGCAATTTAAAGG - Intergenic
982199924 4:152950265-152950287 GCAGTGATAACCCTCTTTAAAGG + Intronic
984247487 4:177293090-177293112 GTAGTTATAATGCACTAAAATGG - Intergenic
984608883 4:181816020-181816042 GCAGTGATCATGCAAATCAATGG - Intergenic
984817834 4:183854722-183854744 GCACTGAAAATACAATTTAATGG + Intronic
984932025 4:184856553-184856575 AGAGTGATAATGCATTTTAAAGG + Intergenic
986563133 5:9084007-9084029 GCAATGATATTCCACTTTTAGGG - Intronic
987089886 5:14501263-14501285 CCATTTATAAAGCACTTTAAAGG + Intronic
987882983 5:23774020-23774042 GCGATGAGAATGCACTTAAATGG - Intergenic
989377501 5:40779860-40779882 ATTGTGATAATGCACTTTCATGG + Intronic
990410628 5:55537555-55537577 GAAATGACAATGCATTTTAATGG - Intergenic
991203676 5:64024134-64024156 GCAGTGAAAATGTACTTGCAAGG - Intergenic
991337486 5:65565056-65565078 AAAATGATAATGCACTGTAAGGG - Intronic
992692887 5:79257723-79257745 GGACTTACAATGCACTTTAAGGG - Intronic
994055681 5:95411825-95411847 GTTGTGATAATGCACTTTTGTGG + Intronic
994321088 5:98395598-98395620 GTTGTGATAATGCACTTTCATGG + Intergenic
998833783 5:146185022-146185044 GCATCTACAATGCACTTTAAGGG + Intergenic
999300912 5:150489837-150489859 GCAGTAATATTGCCCCTTAAGGG - Intronic
999419958 5:151432242-151432264 ACAGTGATAAAGCACTTTGAAGG + Intergenic
1001486721 5:172125039-172125061 GCTGAGATAATACACTTTCAGGG - Intronic
1002146997 5:177192029-177192051 GCAGTGATTATACATGTTAAAGG + Intronic
1009786488 6:68347023-68347045 GCTGTGATTATGTAATTTAAAGG + Intergenic
1009897634 6:69773107-69773129 GTAGTGATCATGAACTTTGAGGG - Intronic
1013615417 6:111838452-111838474 CAAGTGATAATTCACTTTAGTGG + Intronic
1013841154 6:114396061-114396083 ATTGTGATAATGCACTTCAATGG + Intergenic
1015055410 6:128896808-128896830 GCTGTTATTATTCACTTTAATGG + Intronic
1016304543 6:142670049-142670071 GCAAGGATATTGAACTTTAAAGG - Intergenic
1018878048 6:167843438-167843460 ACATTGTTAATGCACTTAAAAGG + Intronic
1020315486 7:6902597-6902619 GCAGCAATACTGCTCTTTAATGG + Intergenic
1020931493 7:14402217-14402239 GCTGTGATAAGACAGTTTAATGG - Intronic
1021320989 7:19211235-19211257 CCAGTTAGAATGCACTTCAAAGG - Intergenic
1021967159 7:25931488-25931510 GTTGTGATAATGCCCTTTCATGG - Intergenic
1024800726 7:53074462-53074484 GCAGTAATTATGCACTTCACAGG + Intergenic
1025846032 7:65198680-65198702 ATTGTGATAATGCACTTTCATGG + Intergenic
1025896254 7:65704388-65704410 ATTGTGATAATGCACTTTCATGG + Intergenic
1028067096 7:86400165-86400187 GTTGTGATAATGCATTTTTATGG + Intergenic
1029023185 7:97386558-97386580 GCTGTGATAATTCCTTTTAATGG + Intergenic
1029258578 7:99286066-99286088 GCAGTCATCATGCTCTTTACTGG + Intergenic
1030485102 7:110155623-110155645 GCAGTGAAAGTGCAGTTTATGGG + Intergenic
1035144072 7:156795395-156795417 GCAGTTATTATGCTCTTTATAGG - Intronic
1036010059 8:4712051-4712073 GCAGTGAACATGCATTTTATGGG - Intronic
1038061066 8:23913470-23913492 GCATTGAAATTGCAATTTAAGGG - Intergenic
1040678678 8:49783142-49783164 GTAGTGATAATGCACTTTCATGG - Intergenic
1042119652 8:65472340-65472362 GTTGTGATAATGCACTTTTGAGG + Intergenic
1042565648 8:70107086-70107108 GCAGAGATAATATACTTAAAGGG + Intergenic
1049624149 8:143612619-143612641 CCTGTGAAAATGCACTTTATTGG + Exonic
1050402729 9:5273155-5273177 GGTGTGATAATGGACTTTAGTGG + Intergenic
1051334048 9:16050642-16050664 GTTGTGATAATGCACTTTTGTGG - Intronic
1051783017 9:20711318-20711340 GCAGTGAAAATGAAGTTGAATGG + Intronic
1051796541 9:20878090-20878112 GTTGTGATAATGCACTTTTGTGG + Intronic
1187080452 X:15981080-15981102 GCAGTGTTAAAGCAATTTATAGG + Intergenic
1188296243 X:28453020-28453042 GTTGTGATAATGCACTTTTGTGG - Intergenic
1189000245 X:36936368-36936390 GTTGTGATAATACACTTTCATGG + Intergenic
1192116136 X:68413293-68413315 GCAGGGCTAATGTACATTAATGG - Intronic
1194224045 X:91232802-91232824 GTTGTGATAATGCACTTTTGTGG + Intergenic
1194970733 X:100340585-100340607 GCAGAGATAATACACTTTCTGGG - Intronic
1196484597 X:116190482-116190504 CCAGTGATAATGAGCTTTAATGG + Intergenic
1196665701 X:118313804-118313826 GTTGTGATAATGTACTTTCATGG + Intergenic
1197213989 X:123851160-123851182 GCAGTGTTAATGGACTGTAAAGG - Intergenic
1201226733 Y:11825737-11825759 GCAGAGATAATTCATTTTCATGG - Intergenic
1201419548 Y:13783208-13783230 GAAGTTATAATGCACCTTAAGGG + Intergenic
1201854859 Y:18529954-18529976 GCAGTGACCACGCATTTTAACGG + Intergenic
1201878462 Y:18790431-18790453 GCAGTGACCACGCATTTTAACGG - Intronic