ID: 1137924460

View in Genome Browser
Species Human (GRCh38)
Location 16:52526687-52526709
Sequence CAGGCGTAGTAGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137924454_1137924460 -4 Left 1137924454 16:52526668-52526690 CCCTCTCCTTTGGGAATTCCAGG 0: 1
1: 1
2: 2
3: 20
4: 262
Right 1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 237
1137924457_1137924460 -10 Left 1137924457 16:52526674-52526696 CCTTTGGGAATTCCAGGCGTAGT 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 237
1137924453_1137924460 -3 Left 1137924453 16:52526667-52526689 CCCCTCTCCTTTGGGAATTCCAG 0: 1
1: 0
2: 3
3: 29
4: 279
Right 1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 237
1137924456_1137924460 -5 Left 1137924456 16:52526669-52526691 CCTCTCCTTTGGGAATTCCAGGC 0: 1
1: 0
2: 1
3: 22
4: 330
Right 1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 237
1137924450_1137924460 28 Left 1137924450 16:52526636-52526658 CCAGAGAGGGGACATTGTTGTCT 0: 1
1: 1
2: 2
3: 9
4: 136
Right 1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137924460 Original CRISPR CAGGCGTAGTAGAGAGAAGA GGG Intronic
900964957 1:5951506-5951528 CAGATGGAGTAGGGAGAAGAGGG - Intronic
901309802 1:8260554-8260576 CACGTGTAGTAGTGAGAAGGAGG + Intergenic
902565338 1:17307831-17307853 CAGGCATATCAGAGAGGAGAAGG - Intergenic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
904575666 1:31503642-31503664 CAAGTGTAGTAGTGAGAAGTGGG + Intergenic
905953492 1:41972991-41973013 CAGGCAAAGAAGATAGAAGAAGG + Intronic
906252389 1:44320583-44320605 CGTGCGTACCAGAGAGAAGAGGG + Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
914959271 1:152191683-152191705 CAGGTGTAGGGGAGAGAACAGGG + Intergenic
917238164 1:172917144-172917166 CAGGCAAAGGAGAGAGGAGAAGG - Intergenic
918182306 1:182094979-182095001 CAGGCCTTGGAGAGAGAGGATGG - Intergenic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
918873127 1:190002940-190002962 TAGGGGTAGTATAGAGAAGCTGG - Intergenic
919930230 1:202216624-202216646 GAGAGGTAGTAGAGAGCAGAGGG + Intronic
920298734 1:204975636-204975658 GAGGTGTAGGAGAGAGAAGCAGG - Intronic
920892593 1:210005177-210005199 CAGGCTTAGTAGGGGAAAGATGG + Intronic
922540437 1:226414842-226414864 CAGGCTTTGTAGTGACAAGATGG - Intergenic
924059250 1:240154662-240154684 CAAGTGTAGTAGTGAGAAGAAGG + Intronic
924216451 1:241827059-241827081 CAGAAGTATTAGGGAGAAGAGGG + Intergenic
924259274 1:242212844-242212866 CAGGGGTAGGAGAGAGATAACGG - Intronic
924416134 1:243858693-243858715 GAGGGGTAGTAAATAGAAGAAGG + Intergenic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
1065861994 10:29879583-29879605 CAGGCCTAGTAGAAGGAAGCAGG - Intergenic
1065989946 10:30999298-30999320 GGGACTTAGTAGAGAGAAGAGGG - Intronic
1067155103 10:43775039-43775061 CAGGCGTAGCCCAGAGAAGAGGG + Intergenic
1067934979 10:50602490-50602512 CAGGGGAAGAAGGGAGAAGAAGG + Intronic
1071666402 10:87563099-87563121 CAAGTGTAGTAGTGAGAAGAGGG + Intergenic
1072244854 10:93534303-93534325 CTGGCATGGTAGAAAGAAGATGG - Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1075451239 10:122553149-122553171 CAGGGGTGGGAGGGAGAAGAGGG + Intergenic
1078083323 11:8219165-8219187 CATGAGTTGTAGAGAGAAAAAGG + Intergenic
1078288626 11:9983559-9983581 CAGGTGTAGTAGTGTGGAGAGGG - Intronic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1079151000 11:17899004-17899026 CAGGAGCAGGAGAGAGAAGGAGG - Intronic
1081555590 11:44157758-44157780 CAGGGGAAGGAGAGAGAAAAGGG - Intronic
1082730911 11:56796424-56796446 GAGGTGGAGTAGATAGAAGAGGG + Intergenic
1082768952 11:57190949-57190971 GAGGCGCAGGAGAGAGCAGAGGG - Exonic
1084519274 11:69653654-69653676 CAGGCGCAGGGAAGAGAAGAGGG - Exonic
1085355763 11:75835226-75835248 CAAGTGTAGTAGTGAGAAGCGGG + Intronic
1086446123 11:86872751-86872773 CAGGAGTAGTAGAAAGAAATGGG + Intronic
1087071420 11:94085059-94085081 TAGGCTTAGTAGAGAGCAGGAGG + Intronic
1087901781 11:103649440-103649462 CAGGTGTAGGTGAGACAAGATGG + Intergenic
1089054557 11:115575052-115575074 GAGGGGTGGTGGAGAGAAGATGG + Intergenic
1092129199 12:6096843-6096865 CAGGCCTGGAAGAGAGAAGTAGG + Intronic
1095631690 12:44384340-44384362 CATGCGCAGGAGGGAGAAGAAGG + Intronic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1100690723 12:97036084-97036106 CTGGTGTAGTAAAAAGAAGATGG - Intergenic
1104608435 12:130206739-130206761 AGGGCGTAATAGAGAGAGGAAGG + Intergenic
1105058427 12:133125866-133125888 CAGGCCTGATGGAGAGAAGAAGG + Intronic
1105894073 13:24703567-24703589 CAAGTGCAGTAGTGAGAAGAGGG + Intronic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1108730139 13:53226584-53226606 TAGGTGTAGAAGAGAGAGGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112155299 13:96810319-96810341 AAGGGGTAGAAGAGAGAAGAAGG + Intronic
1113864319 13:113511297-113511319 CAGGCATAGAAGAGAAAATACGG + Intronic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1114916099 14:27267235-27267257 AAGCCAAAGTAGAGAGAAGAAGG + Intergenic
1116670854 14:47841288-47841310 GAGGCCTAGTTGAGAGTAGAGGG - Intergenic
1117051320 14:51862677-51862699 CGGGCATAGTAGAGTCAAGAGGG + Intronic
1118195477 14:63621838-63621860 CAAGTGCAGTAGTGAGAAGAGGG - Intronic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1119074341 14:71621037-71621059 CAGGGGCAGGAGGGAGAAGATGG - Intronic
1119684946 14:76624090-76624112 CAGGCGTTGGAGGAAGAAGAGGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1125964621 15:43863904-43863926 CAAGTGTAGTAGTGAGAAGGTGG + Intronic
1128650226 15:69406519-69406541 CAAGTGCAGTAGTGAGAAGAGGG - Exonic
1131465671 15:92653321-92653343 CAGGAGTAGGGGAGAAAAGAAGG - Intronic
1132172961 15:99681797-99681819 CAGGTGCAGTAGTGAGAAGGGGG + Intronic
1132676768 16:1124287-1124309 CAGGCCAAGGGGAGAGAAGAGGG + Intergenic
1133033685 16:3023295-3023317 CAGGCTGAGTTGAGAGAAGTGGG + Exonic
1133449608 16:5892731-5892753 CAGGGGTAGTGGGGAGAAAATGG + Intergenic
1136120745 16:28132007-28132029 CAGGTGTACTAGGGAGAACATGG - Intronic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137629769 16:49934803-49934825 CAAGCACAGGAGAGAGAAGAGGG + Intergenic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1139068447 16:63349129-63349151 CAGGGGTAGGGTAGAGAAGAAGG - Intergenic
1139640884 16:68290643-68290665 AAGGGGGAGTAGGGAGAAGAGGG - Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1147035952 17:37680998-37681020 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1147037041 17:37689345-37689367 CAGGTGGAGGAGAGAGAAAACGG + Intronic
1148080628 17:44966199-44966221 CAGGCAGAGGAAAGAGAAGAAGG + Intronic
1148083005 17:44977773-44977795 CAGGGGTAGGAGTGAGCAGAGGG - Intergenic
1149398087 17:56265337-56265359 CAGGCGAGAAAGAGAGAAGAAGG + Intronic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1153197911 18:2621168-2621190 CAAGTGTAGTAGTGAGAAGAGGG - Intergenic
1155490721 18:26399137-26399159 CATACATAGTAGAGAGAGGATGG - Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1157380076 18:47206331-47206353 CAGGCAAAGTACAGAGAGGAAGG + Intergenic
1161976542 19:7610857-7610879 CAGCTGCAGTACAGAGAAGAGGG - Exonic
1162594756 19:11619676-11619698 CAGTCATATTAGTGAGAAGAGGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1166271246 19:41715507-41715529 CAGGCTCAGTAGATACAAGAGGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1168152546 19:54456654-54456676 CAAGCGCAGTCGAAAGAAGATGG + Exonic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
928080528 2:28308543-28308565 CAGGCCTGATGGAGAGAAGAAGG + Intronic
929282443 2:40095696-40095718 AAGGCCTGGTAGAGAGAAGAGGG + Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
929881865 2:45843811-45843833 GAGGAGTAGGAGAGAAAAGAAGG - Intronic
929960494 2:46492609-46492631 CAGGCATAGCAGATTGAAGAGGG - Intronic
932150144 2:69363404-69363426 CAGAAGTAGTAGAGAGCATATGG - Intronic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932627971 2:73314076-73314098 GAGGAGTAGAAAAGAGAAGAGGG + Intergenic
937645104 2:124257821-124257843 CAGACCAAGTAGAGAGATGAAGG - Intronic
938570927 2:132561245-132561267 CAGGTTTAGGAGAGAAAAGAAGG - Intronic
938660998 2:133487253-133487275 CAGGAGGAGTAGAGAGACTAGGG + Intronic
939142634 2:138373865-138373887 CAGAAGTAGAAGAGAGTAGAAGG - Intergenic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
941489249 2:166123500-166123522 CAAGAGCAGTAGTGAGAAGAGGG + Intronic
941898520 2:170655260-170655282 CAGTCACAGTATAGAGAAGACGG + Intergenic
945656529 2:212631240-212631262 CAGGTGGAGGAAAGAGAAGATGG + Intergenic
945997540 2:216450744-216450766 CAGGGGTGGTTGTGAGAAGAGGG + Intronic
946151158 2:217772110-217772132 AAAGCATACTAGAGAGAAGATGG - Intergenic
946392911 2:219426996-219427018 AAGGTGTAGTAGAGAGCACAAGG - Intergenic
946588717 2:221219545-221219567 CAGGGATAGTATATAGAAGAAGG + Intergenic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
946744892 2:222835861-222835883 CAGCTTTAGTAGAGAGAAGCTGG + Intergenic
1169652060 20:7880225-7880247 CAAGCCTCGTAAAGAGAAGAAGG + Intergenic
1170014792 20:11768497-11768519 CAGGAACAGGAGAGAGAAGAGGG + Intergenic
1170488075 20:16840495-16840517 CAGTCCTAGAAGAGAGAAGCTGG + Intergenic
1171165626 20:22967675-22967697 CAGCTGTAGTAGGGTGAAGAGGG - Intergenic
1177928351 21:27248196-27248218 GAGGAGGAGGAGAGAGAAGAAGG - Intergenic
1181178482 22:21051491-21051513 CAGCTGTGGTAGAGAGGAGATGG - Intronic
1183170557 22:36184668-36184690 CAGGAGGAGAATAGAGAAGAGGG - Intergenic
1184200258 22:42963739-42963761 CGGGTGTGGTAGAGAGAGGAGGG - Intronic
949628771 3:5898953-5898975 AAGACATAGTAGAGAGTAGAGGG - Intergenic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950118162 3:10464535-10464557 CAGGCAGAGAAGAGAGGAGAGGG - Intronic
950793024 3:15488339-15488361 CAGGCGTAGGGGACAGAGGAAGG + Intronic
953521544 3:43647956-43647978 CAGCCAAAGTAGAGAGATGAGGG - Intronic
955567509 3:60263661-60263683 CAGGGGTGGTAGAGAGGAGGTGG + Intronic
958057519 3:88431277-88431299 CAAGTGCAGTAGTGAGAAGAAGG - Intergenic
962842930 3:139251979-139252001 CAGGGGAAGAAGAGAAAAGAGGG + Intronic
963832018 3:150018264-150018286 AAGGCAAAGGAGAGAGAAGAGGG + Intronic
964160679 3:153641215-153641237 CAGCTGTAGTAGTGTGAAGAGGG - Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965630092 3:170724259-170724281 TAGGTGTAGAAGAGAGACGAGGG + Intronic
967292605 3:187935939-187935961 CGGGAGTAATAGTGAGAAGAGGG + Intergenic
968683744 4:1941332-1941354 CAGGTACAGTAGAGAGAACATGG + Intronic
968744447 4:2352424-2352446 GAGGCGTGGAAGAGGGAAGAAGG + Intronic
968871191 4:3243393-3243415 CACGTGTAGGAGTGAGAAGAAGG + Exonic
970538654 4:17055628-17055650 CAGGTGTAGATGAGAAAAGAAGG + Intergenic
971455564 4:26840863-26840885 CAGGCTGAGAAGTGAGAAGAAGG - Intergenic
971525570 4:27613653-27613675 CTGGCCTAGGAGAGAGTAGAGGG - Intergenic
973903443 4:55501606-55501628 CAAGTGCAGTAGTGAGAAGAGGG + Intronic
974080704 4:57209461-57209483 CATGGGTAGAAGAGAAAAGACGG - Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977417492 4:96751613-96751635 CAGGCGAAGTAGTGAGTAGAGGG - Intergenic
979294747 4:119018659-119018681 GAAGGGTAGTAGAGAGGAGAGGG + Intronic
980269382 4:130564128-130564150 TAGGCTTAGTAGAGAGAAACTGG - Intergenic
980933140 4:139200480-139200502 CAAGTGTAGTAGTGAGAAGGAGG - Intergenic
981294764 4:143118983-143119005 CAGGAGTCCTAGAGAGAGGAAGG - Intergenic
981513810 4:145585834-145585856 CAGGCATAGGAGAGAGAACAAGG + Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982742692 4:159074300-159074322 CAGGCGTAGAAGAGAGCTGCAGG + Intergenic
984419029 4:179496281-179496303 CAGGCATAGTGGAGAGAAGTGGG - Intergenic
985485084 5:144098-144120 CAAGTGTAGTAGTGAGAAGGGGG + Intronic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
987865419 5:23529459-23529481 CAGGGGTGGTGCAGAGAAGAAGG + Intergenic
989083288 5:37649151-37649173 CAGGCAGAGAGGAGAGAAGAAGG + Intronic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
993105138 5:83592122-83592144 CAGGTGTGGTAGAAAGCAGATGG + Intergenic
998399782 5:141842660-141842682 CCAGAGAAGTAGAGAGAAGAGGG + Intergenic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1002402946 5:179002239-179002261 CAAGAGGAGTAGAGAGAAGGGGG + Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1004150525 6:13115472-13115494 CATGGGTAGAAGGGAGAAGAAGG - Intronic
1004735070 6:18397738-18397760 CAGACGAAGCAGAGAAAAGAAGG - Intronic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006337719 6:33429113-33429135 CAGACTTAGAAGAGAGAACAGGG + Intronic
1006936900 6:37724920-37724942 CAGGTGGAGTAGGGAAAAGACGG + Intergenic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1015336180 6:132041505-132041527 CAGGAGTAGGAGAGAGCACAGGG - Intergenic
1015736284 6:136403172-136403194 AAGGCGTAGCAGAGAGAGGTGGG - Intronic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1017265629 6:152442169-152442191 CAGGCGCAGCAGGGAGAAGGGGG - Exonic
1017519417 6:155188308-155188330 CAGGCATAGTGGAGTGAAGCTGG - Intronic
1018814856 6:167322976-167322998 CAGGCTCAGTAGAGGGTAGAAGG + Intergenic
1019018813 6:168900657-168900679 CAGCCGCAGGAGTGAGAAGAGGG + Intergenic
1019567642 7:1692439-1692461 CAGGCAGAGTAGAGAGGAGTGGG + Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023680771 7:42684999-42685021 CAGGCTTTCTAGAGAGATGAGGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024280148 7:47711815-47711837 CAGGTGTAGAAGTGAGGAGAAGG + Intronic
1025025985 7:55516563-55516585 CAGGCAGAGTAGGGAGAAGGCGG + Intronic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1029667568 7:102005705-102005727 CAGGTGGAGTAGACAGAGGAGGG - Intronic
1029984620 7:104911711-104911733 CAGGAGAAATAGAGAGAATAAGG + Intergenic
1030031089 7:105370203-105370225 GAGATGTAGTAGAGATAAGATGG - Intronic
1030799096 7:113827311-113827333 GAGGAGTAGAAGAGAGAAAATGG + Intergenic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033211895 7:139466101-139466123 GAGGAGTAGTAGATAGCAGATGG - Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034714234 7:153224859-153224881 CTTGCATAGAAGAGAGAAGAAGG + Intergenic
1035385611 7:158470642-158470664 CAAGTGCAGTAGAGAGAAGGCGG - Intronic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039183350 8:34890896-34890918 CAGGCTTACTGGAGAGAACATGG + Intergenic
1039947734 8:42144446-42144468 CAGCCTTGGTAGAGACAAGAGGG - Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041447142 8:57964770-57964792 CAGGCAGAGAAGAGAGAAAAGGG + Intergenic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1042803259 8:72744197-72744219 GAGACCTAGTAGAGAGCAGAAGG + Intronic
1043018847 8:74975361-74975383 CAGGCTTGGTAGCAAGAAGAGGG + Intergenic
1043358252 8:79439323-79439345 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1043466277 8:80510686-80510708 CAAGTGCAGTAGTGAGAAGAGGG + Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1045284623 8:100779681-100779703 TAGGCGTAGTAGAGCTGAGATGG + Intergenic
1047816166 8:128465423-128465445 CAGGTATAGTAGAGATAAAAGGG + Intergenic
1048231440 8:132645491-132645513 TAGGCAAAGTGGAGAGAAGAAGG + Intronic
1050146047 9:2568792-2568814 CAGGGGTTGAAGAGAGAAAATGG - Intergenic
1050365749 9:4872219-4872241 TAGGGTTAGAAGAGAGAAGAGGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053340460 9:37322338-37322360 CAAGTGTAGTAGTGAGAAGGGGG - Intronic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057765634 9:97915768-97915790 CAAGTGCAGTAGTGAGAAGAGGG - Intronic
1186804600 X:13127383-13127405 CATCCACAGTAGAGAGAAGAGGG + Intergenic
1190023090 X:46897168-46897190 CAGGCTTACTAGGGAGAACATGG + Intronic
1190063213 X:47223899-47223921 CAGACGGTGTTGAGAGAAGATGG - Intronic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1194127734 X:90040922-90040944 GAGGCGTAGTGGAGAGACAAGGG - Intergenic
1194366605 X:93020846-93020868 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1196586578 X:117436109-117436131 CAGGGGTAGAGGAGAGAAGGGGG - Intergenic
1197312437 X:124921688-124921710 CAGGAGTGGGAGTGAGAAGAAGG - Intronic
1198608658 X:138372949-138372971 GAGGCGTAGGAGAGAAAAAACGG + Intergenic
1200674832 Y:6137107-6137129 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1202241986 Y:22780640-22780662 CATGACAAGTAGAGAGAAGAAGG - Intergenic
1202394970 Y:24414384-24414406 CATGACAAGTAGAGAGAAGAAGG - Intergenic
1202475814 Y:25255708-25255730 CATGACAAGTAGAGAGAAGAAGG + Intergenic