ID: 1137926286

View in Genome Browser
Species Human (GRCh38)
Location 16:52545887-52545909
Sequence GGTCCTCGAAGTTGGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137926281_1137926286 -8 Left 1137926281 16:52545872-52545894 CCACCTGGAACGCTCGGTCCTCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926275_1137926286 12 Left 1137926275 16:52545852-52545874 CCCTTCTGAGGTCCACCTCGCCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926276_1137926286 11 Left 1137926276 16:52545853-52545875 CCTTCTGAGGTCCACCTCGCCAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926280_1137926286 -3 Left 1137926280 16:52545867-52545889 CCTCGCCACCTGGAACGCTCGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926278_1137926286 0 Left 1137926278 16:52545864-52545886 CCACCTCGCCACCTGGAACGCTC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926273_1137926286 19 Left 1137926273 16:52545845-52545867 CCCGCTGCCCTTCTGAGGTCCAC 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926271_1137926286 29 Left 1137926271 16:52545835-52545857 CCGAGCGACGCCCGCTGCCCTTC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43
1137926274_1137926286 18 Left 1137926274 16:52545846-52545868 CCGCTGCCCTTCTGAGGTCCACC 0: 1
1: 0
2: 5
3: 22
4: 306
Right 1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137926286 Original CRISPR GGTCCTCGAAGTTGGCGCAG GGG Intronic