ID: 1137926937

View in Genome Browser
Species Human (GRCh38)
Location 16:52548531-52548553
Sequence CGTTAAATGGAGACTAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137926937_1137926942 -8 Left 1137926937 16:52548531-52548553 CCCTCCCTAGTCTCCATTTAACG No data
Right 1137926942 16:52548546-52548568 ATTTAACGTTGACAACCCAGCGG No data
1137926937_1137926943 5 Left 1137926937 16:52548531-52548553 CCCTCCCTAGTCTCCATTTAACG No data
Right 1137926943 16:52548559-52548581 AACCCAGCGGTGCTCCCTAATGG No data
1137926937_1137926946 14 Left 1137926937 16:52548531-52548553 CCCTCCCTAGTCTCCATTTAACG No data
Right 1137926946 16:52548568-52548590 GTGCTCCCTAATGGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137926937 Original CRISPR CGTTAAATGGAGACTAGGGA GGG (reversed) Intergenic
No off target data available for this crispr